FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635027_at:

>probe:Drosophila_2:1635027_at:716:435; Interrogation_Position=115; Antisense; GAGGATATCATCGAATTGGCCCAAC
>probe:Drosophila_2:1635027_at:42:657; Interrogation_Position=243; Antisense; TAAGGAGTCCACTCTCAACCGAGAT
>probe:Drosophila_2:1635027_at:337:623; Interrogation_Position=276; Antisense; TGCGGCCTGCAATTTCACCAAAAAA
>probe:Drosophila_2:1635027_at:531:179; Interrogation_Position=296; Antisense; AAAAACCCGGACACATCTATCATCT
>probe:Drosophila_2:1635027_at:153:69; Interrogation_Position=328; Antisense; AGGCCATCGGGTCAAAACTATTTCA
>probe:Drosophila_2:1635027_at:254:711; Interrogation_Position=349; Antisense; TTCAGCATGCTATCACCGGAAGAAT
>probe:Drosophila_2:1635027_at:712:369; Interrogation_Position=370; Antisense; GAATGGAGTCTCTCCGTTGACCAAA
>probe:Drosophila_2:1635027_at:681:549; Interrogation_Position=417; Antisense; GGAGTACGATTTGAGCTGGACCCCA
>probe:Drosophila_2:1635027_at:185:333; Interrogation_Position=431; Antisense; GCTGGACCCCACTGGACAAGATTAA
>probe:Drosophila_2:1635027_at:353:717; Interrogation_Position=522; Antisense; TTCGGCCATGGCAATTGACTTTAAT
>probe:Drosophila_2:1635027_at:105:435; Interrogation_Position=594; Antisense; GAGGTTGTACCCAAACTTCGATGTT
>probe:Drosophila_2:1635027_at:33:427; Interrogation_Position=61; Antisense; GAGAGGAATCCCCAGTTGCAGATAA
>probe:Drosophila_2:1635027_at:640:467; Interrogation_Position=75; Antisense; GTTGCAGATAAACCCCATGCGTGTG
>probe:Drosophila_2:1635027_at:302:51; Interrogation_Position=91; Antisense; ATGCGTGTGTCCATGCACCAGGAGG

Paste this into a BLAST search page for me
GAGGATATCATCGAATTGGCCCAACTAAGGAGTCCACTCTCAACCGAGATTGCGGCCTGCAATTTCACCAAAAAAAAAAACCCGGACACATCTATCATCTAGGCCATCGGGTCAAAACTATTTCATTCAGCATGCTATCACCGGAAGAATGAATGGAGTCTCTCCGTTGACCAAAGGAGTACGATTTGAGCTGGACCCCAGCTGGACCCCACTGGACAAGATTAATTCGGCCATGGCAATTGACTTTAATGAGGTTGTACCCAAACTTCGATGTTGAGAGGAATCCCCAGTTGCAGATAAGTTGCAGATAAACCCCATGCGTGTGATGCGTGTGTCCATGCACCAGGAGG

Full Affymetrix probeset data:

Annotations for 1635027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720