FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635030_at:

>probe:Drosophila_2:1635030_at:129:299; Interrogation_Position=112; Antisense; CCCAAACTCAATCCCTACATAGTAG
>probe:Drosophila_2:1635030_at:116:247; Interrogation_Position=137; Antisense; AATTCTTTGGAGTTCTTAGCTTGAC
>probe:Drosophila_2:1635030_at:704:471; Interrogation_Position=148; Antisense; GTTCTTAGCTTGACAGATCTCCGTG
>probe:Drosophila_2:1635030_at:424:531; Interrogation_Position=191; Antisense; GGGTCATATATCACGCCAAGCAGCC
>probe:Drosophila_2:1635030_at:517:125; Interrogation_Position=212; Antisense; AGCCTGATCTGGACAAGACCGTTGA
>probe:Drosophila_2:1635030_at:91:23; Interrogation_Position=266; Antisense; ATATGTTTGATCTGTACCGCACACC
>probe:Drosophila_2:1635030_at:468:673; Interrogation_Position=280; Antisense; TACCGCACACCAGTTTTCAGTGGAG
>probe:Drosophila_2:1635030_at:228:711; Interrogation_Position=295; Antisense; TTCAGTGGAGTTGCTCTGCGGGACA
>probe:Drosophila_2:1635030_at:130:105; Interrogation_Position=325; Antisense; AGAAAGCACTTCTCGAACCTAAAGT
>probe:Drosophila_2:1635030_at:667:397; Interrogation_Position=357; Antisense; GACGGGAAATCTCCTGGAAGCCCCA
>probe:Drosophila_2:1635030_at:587:517; Interrogation_Position=409; Antisense; GTGGTGAAAACCATCACGGATCTGC
>probe:Drosophila_2:1635030_at:706:545; Interrogation_Position=426; Antisense; GGATCTGCATCATCTGGAACACCAG
>probe:Drosophila_2:1635030_at:729:23; Interrogation_Position=479; Antisense; ATATGTGGTCTATGCGGTATCGCTA
>probe:Drosophila_2:1635030_at:87:439; Interrogation_Position=55; Antisense; GAGGAAATCGACAGCCATTTGAGAA

Paste this into a BLAST search page for me
CCCAAACTCAATCCCTACATAGTAGAATTCTTTGGAGTTCTTAGCTTGACGTTCTTAGCTTGACAGATCTCCGTGGGGTCATATATCACGCCAAGCAGCCAGCCTGATCTGGACAAGACCGTTGAATATGTTTGATCTGTACCGCACACCTACCGCACACCAGTTTTCAGTGGAGTTCAGTGGAGTTGCTCTGCGGGACAAGAAAGCACTTCTCGAACCTAAAGTGACGGGAAATCTCCTGGAAGCCCCAGTGGTGAAAACCATCACGGATCTGCGGATCTGCATCATCTGGAACACCAGATATGTGGTCTATGCGGTATCGCTAGAGGAAATCGACAGCCATTTGAGAA

Full Affymetrix probeset data:

Annotations for 1635030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720