Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635032_a_at:

>probe:Drosophila_2:1635032_a_at:586:25; Interrogation_Position=320; Antisense; ATAGGATGACCTTCTATCGCTACAA
>probe:Drosophila_2:1635032_a_at:670:615; Interrogation_Position=350; Antisense; TGCACTGCCTGGACTATGATCTTTG
>probe:Drosophila_2:1635032_a_at:483:57; Interrogation_Position=365; Antisense; ATGATCTTTGCTCCGACTGCAAGGA
>probe:Drosophila_2:1635032_a_at:307:255; Interrogation_Position=401; Antisense; CAAACGGGTTGCACAGTCTGGATCA
>probe:Drosophila_2:1635032_a_at:480:451; Interrogation_Position=445; Antisense; GATCGTGATGCACTTGAGCTGCACT
>probe:Drosophila_2:1635032_a_at:523:125; Interrogation_Position=479; Antisense; AGCCGATTCCGATATTGTGCGCCGA
>probe:Drosophila_2:1635032_a_at:446:649; Interrogation_Position=509; Antisense; TCACGTGCCCAGTGTGCGGTGAAAT
>probe:Drosophila_2:1635032_a_at:315:455; Interrogation_Position=571; Antisense; GATAATCATCGCATGGCGCGCACAG
>probe:Drosophila_2:1635032_a_at:97:357; Interrogation_Position=590; Antisense; GCACAGTTTGCATTTGCCCAGTCTG
>probe:Drosophila_2:1635032_a_at:492:431; Interrogation_Position=639; Antisense; GAGTCACATTGCTCACATTGCCAAT
>probe:Drosophila_2:1635032_a_at:164:629; Interrogation_Position=657; Antisense; TGCCAATCACTTGATGTTCTCGCCA
>probe:Drosophila_2:1635032_a_at:602:107; Interrogation_Position=755; Antisense; AGAACTCTGCCGTGAGCTCTGGATC
>probe:Drosophila_2:1635032_a_at:136:653; Interrogation_Position=786; Antisense; TCAACACACTTTTTCCAGCTCGGAA
>probe:Drosophila_2:1635032_a_at:520:301; Interrogation_Position=850; Antisense; CCCTTAGCTGATTCCGACGATTTTA

Paste this into a BLAST search page for me
ATAGGATGACCTTCTATCGCTACAATGCACTGCCTGGACTATGATCTTTGATGATCTTTGCTCCGACTGCAAGGACAAACGGGTTGCACAGTCTGGATCAGATCGTGATGCACTTGAGCTGCACTAGCCGATTCCGATATTGTGCGCCGATCACGTGCCCAGTGTGCGGTGAAATGATAATCATCGCATGGCGCGCACAGGCACAGTTTGCATTTGCCCAGTCTGGAGTCACATTGCTCACATTGCCAATTGCCAATCACTTGATGTTCTCGCCAAGAACTCTGCCGTGAGCTCTGGATCTCAACACACTTTTTCCAGCTCGGAACCCTTAGCTGATTCCGACGATTTTA

Full Affymetrix probeset data:

Annotations for 1635032_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime