FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635033_at:

>probe:Drosophila_2:1635033_at:492:163; Interrogation_Position=226; Antisense; AAATCTAGTGCCGTTCGTCTTGGAG
>probe:Drosophila_2:1635033_at:666:711; Interrogation_Position=272; Antisense; TTGCAGTGACCAAGGCCTTTCGGAA
>probe:Drosophila_2:1635033_at:527:231; Interrogation_Position=367; Antisense; AATGCTGTTATCAGGCCCATTTGCA
>probe:Drosophila_2:1635033_at:170:71; Interrogation_Position=379; Antisense; AGGCCCATTTGCATTATCACGGATC
>probe:Drosophila_2:1635033_at:194:495; Interrogation_Position=554; Antisense; GTCAGATCTGCGCAGGACATCCGGA
>probe:Drosophila_2:1635033_at:577:435; Interrogation_Position=605; Antisense; GAGGTCCATTGATTCATCCGGTATA
>probe:Drosophila_2:1635033_at:383:269; Interrogation_Position=630; Antisense; CATGGATGGATCTCTGCGGTACGTG
>probe:Drosophila_2:1635033_at:105:331; Interrogation_Position=645; Antisense; GCGGTACGTGCAACTGGGAATCATC
>probe:Drosophila_2:1635033_at:200:565; Interrogation_Position=661; Antisense; GGAATCATCAGTTTTGGAAGCTCAC
>probe:Drosophila_2:1635033_at:11:377; Interrogation_Position=677; Antisense; GAAGCTCACTATGCAACAGTCCTGG
>probe:Drosophila_2:1635033_at:406:287; Interrogation_Position=712; Antisense; CGGCTATCAAGCTTTATCGACTGGA
>probe:Drosophila_2:1635033_at:494:485; Interrogation_Position=748; Antisense; GTAGATAACTACACGGTACGCAGTC
>probe:Drosophila_2:1635033_at:141:489; Interrogation_Position=763; Antisense; GTACGCAGTCCACCGAAGATTCAGT
>probe:Drosophila_2:1635033_at:210:265; Interrogation_Position=784; Antisense; CAGTATCGAGTATGGCCTTACGGTA

Paste this into a BLAST search page for me
AAATCTAGTGCCGTTCGTCTTGGAGTTGCAGTGACCAAGGCCTTTCGGAAAATGCTGTTATCAGGCCCATTTGCAAGGCCCATTTGCATTATCACGGATCGTCAGATCTGCGCAGGACATCCGGAGAGGTCCATTGATTCATCCGGTATACATGGATGGATCTCTGCGGTACGTGGCGGTACGTGCAACTGGGAATCATCGGAATCATCAGTTTTGGAAGCTCACGAAGCTCACTATGCAACAGTCCTGGCGGCTATCAAGCTTTATCGACTGGAGTAGATAACTACACGGTACGCAGTCGTACGCAGTCCACCGAAGATTCAGTCAGTATCGAGTATGGCCTTACGGTA

Full Affymetrix probeset data:

Annotations for 1635033_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720