FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635035_at:

>probe:Drosophila_2:1635035_at:356:187; Interrogation_Position=3813; Antisense; AACTTGGTTCCTGTTGATTAAAGAG
>probe:Drosophila_2:1635035_at:169:707; Interrogation_Position=3865; Antisense; TTACGACCTAAGTTCAATGCATTCT
>probe:Drosophila_2:1635035_at:496:11; Interrogation_Position=3885; Antisense; ATTCTTTTGCATTTTTTGACTTTCA
>probe:Drosophila_2:1635035_at:421:159; Interrogation_Position=3918; Antisense; ACAATTTCAATTCGTATGCCACTAT
>probe:Drosophila_2:1635035_at:709:263; Interrogation_Position=3954; Antisense; CAGATATTGTAGACTGCTTTCGATA
>probe:Drosophila_2:1635035_at:182:689; Interrogation_Position=4054; Antisense; TATATTCCTGTGTTACGTGTGCGCC
>probe:Drosophila_2:1635035_at:108:669; Interrogation_Position=4067; Antisense; TACGTGTGCGCCAACTAGCAACAAT
>probe:Drosophila_2:1635035_at:100:241; Interrogation_Position=4089; Antisense; AATAATTTACAGCACTCGCTCTCCC
>probe:Drosophila_2:1635035_at:9:305; Interrogation_Position=4113; Antisense; CCGACACACTCATTTTGCCAAATTG
>probe:Drosophila_2:1635035_at:101:15; Interrogation_Position=4193; Antisense; ATTAGCTGGCATTATTATGGCATTA
>probe:Drosophila_2:1635035_at:30:681; Interrogation_Position=4208; Antisense; TATGGCATTATAGGCTTCCCCATCC
>probe:Drosophila_2:1635035_at:718:307; Interrogation_Position=4227; Antisense; CCATCCGCGAAACGACAGCACATAA
>probe:Drosophila_2:1635035_at:440:111; Interrogation_Position=4243; Antisense; AGCACATAACGATCGTAGCTGAATT
>probe:Drosophila_2:1635035_at:711:707; Interrogation_Position=4299; Antisense; TTCATAAGCCGTTGGGAAAACTCAA

Paste this into a BLAST search page for me
AACTTGGTTCCTGTTGATTAAAGAGTTACGACCTAAGTTCAATGCATTCTATTCTTTTGCATTTTTTGACTTTCAACAATTTCAATTCGTATGCCACTATCAGATATTGTAGACTGCTTTCGATATATATTCCTGTGTTACGTGTGCGCCTACGTGTGCGCCAACTAGCAACAATAATAATTTACAGCACTCGCTCTCCCCCGACACACTCATTTTGCCAAATTGATTAGCTGGCATTATTATGGCATTATATGGCATTATAGGCTTCCCCATCCCCATCCGCGAAACGACAGCACATAAAGCACATAACGATCGTAGCTGAATTTTCATAAGCCGTTGGGAAAACTCAA

Full Affymetrix probeset data:

Annotations for 1635035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720