Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635037_at:

>probe:Drosophila_2:1635037_at:718:161; Interrogation_Position=1830; Antisense; ACAATCAGCCGGTGGCAGTGGAGAA
>probe:Drosophila_2:1635037_at:191:215; Interrogation_Position=1863; Antisense; AAGTAAAGGTTGCACCACCGGCAGC
>probe:Drosophila_2:1635037_at:304:159; Interrogation_Position=1889; Antisense; ACAAATGGTGCTAGCACTCCCACAC
>probe:Drosophila_2:1635037_at:16:469; Interrogation_Position=1979; Antisense; GTTGTTGCTCCCGTCGTTACAGCAA
>probe:Drosophila_2:1635037_at:725:271; Interrogation_Position=2068; Antisense; CTTCCCGCGCTTCAAGAACAACAAG
>probe:Drosophila_2:1635037_at:618:375; Interrogation_Position=2137; Antisense; GAAGACCCTGCTGAATGCGCTGAAA
>probe:Drosophila_2:1635037_at:369:223; Interrogation_Position=2177; Antisense; AAGGTGGCGCCCAGTGAACAGCCGA
>probe:Drosophila_2:1635037_at:613:187; Interrogation_Position=2193; Antisense; AACAGCCGACAGAAAAAGCCGCCGC
>probe:Drosophila_2:1635037_at:684:303; Interrogation_Position=2217; Antisense; CCTCGGACAACGGAACAACGCAGTA
>probe:Drosophila_2:1635037_at:132:207; Interrogation_Position=2282; Antisense; AAGCTGGACTTGAACAGCGGCACCA
>probe:Drosophila_2:1635037_at:223:189; Interrogation_Position=2294; Antisense; AACAGCGGCACCAATGGCGACAATA
>probe:Drosophila_2:1635037_at:644:575; Interrogation_Position=2309; Antisense; GGCGACAATAGCATGTTCATCAAGC
>probe:Drosophila_2:1635037_at:144:207; Interrogation_Position=2330; Antisense; AAGCTGAAAGTTTCGCCGGCCAATG
>probe:Drosophila_2:1635037_at:368:263; Interrogation_Position=2367; Antisense; CAGCGGCGGCCAAGTAGAGATAATC

Paste this into a BLAST search page for me
ACAATCAGCCGGTGGCAGTGGAGAAAAGTAAAGGTTGCACCACCGGCAGCACAAATGGTGCTAGCACTCCCACACGTTGTTGCTCCCGTCGTTACAGCAACTTCCCGCGCTTCAAGAACAACAAGGAAGACCCTGCTGAATGCGCTGAAAAAGGTGGCGCCCAGTGAACAGCCGAAACAGCCGACAGAAAAAGCCGCCGCCCTCGGACAACGGAACAACGCAGTAAAGCTGGACTTGAACAGCGGCACCAAACAGCGGCACCAATGGCGACAATAGGCGACAATAGCATGTTCATCAAGCAAGCTGAAAGTTTCGCCGGCCAATGCAGCGGCGGCCAAGTAGAGATAATC

Full Affymetrix probeset data:

Annotations for 1635037_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime