Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635039_at:

>probe:Drosophila_2:1635039_at:322:587; Interrogation_Position=2167; Antisense; TGGACGAGTGCAGCCTGCTTTCCAA
>probe:Drosophila_2:1635039_at:251:507; Interrogation_Position=2242; Antisense; GTGCCCAAGGATTCGCGGCCGTAAA
>probe:Drosophila_2:1635039_at:597:169; Interrogation_Position=2264; Antisense; AAAGTCGGGACAGCTGCAGTTCACC
>probe:Drosophila_2:1635039_at:386:437; Interrogation_Position=2295; Antisense; GAGGAGCCAACTTGCTTGCAGGACA
>probe:Drosophila_2:1635039_at:442:645; Interrogation_Position=2338; Antisense; TCTTCGCCAGCTCTGTGAAGGATGG
>probe:Drosophila_2:1635039_at:451:439; Interrogation_Position=2358; Antisense; GATGGCGTGAGCAATCTCCAACTGG
>probe:Drosophila_2:1635039_at:336:411; Interrogation_Position=2389; Antisense; GACCCAGCCACATTCGGAGATGCGC
>probe:Drosophila_2:1635039_at:643:297; Interrogation_Position=2415; Antisense; CGCTGCGGATTCGTGTTCGTGAATA
>probe:Drosophila_2:1635039_at:382:577; Interrogation_Position=2465; Antisense; GGCCCTCAAGGCGTGGTTTAGTAAG
>probe:Drosophila_2:1635039_at:558:561; Interrogation_Position=2518; Antisense; GGAAGCAGGTTCACTAGTAAATCTA
>probe:Drosophila_2:1635039_at:236:687; Interrogation_Position=2643; Antisense; TATATTTCTTCTTTGCACGACGTGC
>probe:Drosophila_2:1635039_at:309:693; Interrogation_Position=2654; Antisense; TTTGCACGACGTGCTCGTTCAAAAA
>probe:Drosophila_2:1635039_at:620:659; Interrogation_Position=2682; Antisense; TAAGCCACAGAGAAGTCACCACCAT
>probe:Drosophila_2:1635039_at:534:649; Interrogation_Position=2697; Antisense; TCACCACCATACTTCACTATTTCAA

Paste this into a BLAST search page for me
TGGACGAGTGCAGCCTGCTTTCCAAGTGCCCAAGGATTCGCGGCCGTAAAAAAGTCGGGACAGCTGCAGTTCACCGAGGAGCCAACTTGCTTGCAGGACATCTTCGCCAGCTCTGTGAAGGATGGGATGGCGTGAGCAATCTCCAACTGGGACCCAGCCACATTCGGAGATGCGCCGCTGCGGATTCGTGTTCGTGAATAGGCCCTCAAGGCGTGGTTTAGTAAGGGAAGCAGGTTCACTAGTAAATCTATATATTTCTTCTTTGCACGACGTGCTTTGCACGACGTGCTCGTTCAAAAATAAGCCACAGAGAAGTCACCACCATTCACCACCATACTTCACTATTTCAA

Full Affymetrix probeset data:

Annotations for 1635039_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime