FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635041_at:

>probe:Drosophila_2:1635041_at:112:317; Interrogation_Position=334; Antisense; GCCGATTTGTACATGCCGGATGATC
>probe:Drosophila_2:1635041_at:554:57; Interrogation_Position=353; Antisense; ATGATCCCCAGCTGAGTGGCGAGTG
>probe:Drosophila_2:1635041_at:692:293; Interrogation_Position=372; Antisense; CGAGTGCGTCGAGTCCAACATGGAA
>probe:Drosophila_2:1635041_at:204:585; Interrogation_Position=392; Antisense; TGGAAATTCTCACCATGGACTTTAA
>probe:Drosophila_2:1635041_at:188:221; Interrogation_Position=415; Antisense; AAGGGTTTCCGGCTGTCCATGACAT
>probe:Drosophila_2:1635041_at:333:189; Interrogation_Position=475; Antisense; AACCTGTTTGAACTGACCTACTCGT
>probe:Drosophila_2:1635041_at:164:253; Interrogation_Position=534; Antisense; CAACTTGGACGTGAGGCTGACCTCG
>probe:Drosophila_2:1635041_at:343:131; Interrogation_Position=586; Antisense; ACGCCGGTGGGTAAGTCCTATGTCT
>probe:Drosophila_2:1635041_at:440:75; Interrogation_Position=617; Antisense; AGGAGCAGACTGTGATCATGTACGC
>probe:Drosophila_2:1635041_at:312:601; Interrogation_Position=683; Antisense; TGTATCTGCGCGACATGCACATGCA
>probe:Drosophila_2:1635041_at:283:117; Interrogation_Position=709; Antisense; AGCTTCATGTTCAAGGACAGCGGCA
>probe:Drosophila_2:1635041_at:315:153; Interrogation_Position=763; Antisense; ACAGGATCCTATCGCGACGAGACAG
>probe:Drosophila_2:1635041_at:419:619; Interrogation_Position=824; Antisense; TGCTACTGACCATATCCGGATACGG
>probe:Drosophila_2:1635041_at:661:543; Interrogation_Position=841; Antisense; GGATACGGCGGTTGGAGATACTTCA

Paste this into a BLAST search page for me
GCCGATTTGTACATGCCGGATGATCATGATCCCCAGCTGAGTGGCGAGTGCGAGTGCGTCGAGTCCAACATGGAATGGAAATTCTCACCATGGACTTTAAAAGGGTTTCCGGCTGTCCATGACATAACCTGTTTGAACTGACCTACTCGTCAACTTGGACGTGAGGCTGACCTCGACGCCGGTGGGTAAGTCCTATGTCTAGGAGCAGACTGTGATCATGTACGCTGTATCTGCGCGACATGCACATGCAAGCTTCATGTTCAAGGACAGCGGCAACAGGATCCTATCGCGACGAGACAGTGCTACTGACCATATCCGGATACGGGGATACGGCGGTTGGAGATACTTCA

Full Affymetrix probeset data:

Annotations for 1635041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720