Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635042_s_at:

>probe:Drosophila_2:1635042_s_at:387:319; Interrogation_Position=251; Antisense; GCCGATTATCATGGCACGCAATGTA
>probe:Drosophila_2:1635042_s_at:606:167; Interrogation_Position=289; Antisense; AACATCCATGCACCACAACTGAAGA
>probe:Drosophila_2:1635042_s_at:506:173; Interrogation_Position=317; Antisense; AAAGCACCAGAGAGCACGCGGAACA
>probe:Drosophila_2:1635042_s_at:724:325; Interrogation_Position=360; Antisense; GCGACGGGAGAATGCCAGCAGTTCT
>probe:Drosophila_2:1635042_s_at:591:263; Interrogation_Position=375; Antisense; CAGCAGTTCTGGTCTAAGCAGCGAC
>probe:Drosophila_2:1635042_s_at:43:719; Interrogation_Position=464; Antisense; TTCGACGCCGCAGGAGTCAGTGCAT
>probe:Drosophila_2:1635042_s_at:26:551; Interrogation_Position=476; Antisense; GGAGTCAGTGCATCACCACCGAAGT
>probe:Drosophila_2:1635042_s_at:45:299; Interrogation_Position=558; Antisense; CGCGGTCGTCATCTGATCAGCGAAG
>probe:Drosophila_2:1635042_s_at:686:285; Interrogation_Position=664; Antisense; CGGCCAAGCTACTGCAATTCGGAGT
>probe:Drosophila_2:1635042_s_at:323:363; Interrogation_Position=677; Antisense; GCAATTCGGAGTCCTGCTGCTGATC
>probe:Drosophila_2:1635042_s_at:126:621; Interrogation_Position=706; Antisense; TGCTCGCCACGCATGGAGATCTTGC
>probe:Drosophila_2:1635042_s_at:263:427; Interrogation_Position=721; Antisense; GAGATCTTGCTCAAGCGGAGGGCAA
>probe:Drosophila_2:1635042_s_at:374:563; Interrogation_Position=741; Antisense; GGCAATGTTGGTGAGTGTCCCCTAC
>probe:Drosophila_2:1635042_s_at:672:431; Interrogation_Position=753; Antisense; GAGTGTCCCCTACGAAATAAGCAAG

Paste this into a BLAST search page for me
GCCGATTATCATGGCACGCAATGTAAACATCCATGCACCACAACTGAAGAAAAGCACCAGAGAGCACGCGGAACAGCGACGGGAGAATGCCAGCAGTTCTCAGCAGTTCTGGTCTAAGCAGCGACTTCGACGCCGCAGGAGTCAGTGCATGGAGTCAGTGCATCACCACCGAAGTCGCGGTCGTCATCTGATCAGCGAAGCGGCCAAGCTACTGCAATTCGGAGTGCAATTCGGAGTCCTGCTGCTGATCTGCTCGCCACGCATGGAGATCTTGCGAGATCTTGCTCAAGCGGAGGGCAAGGCAATGTTGGTGAGTGTCCCCTACGAGTGTCCCCTACGAAATAAGCAAG

Full Affymetrix probeset data:

Annotations for 1635042_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime