FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635043_at:

>probe:Drosophila_2:1635043_at:255:43; Interrogation_Position=3720; Antisense; ATCGCCCGAAAAGCCAGAATCTGAC
>probe:Drosophila_2:1635043_at:356:553; Interrogation_Position=3747; Antisense; GGAGCACGAGTCACCGAAATCGCAA
>probe:Drosophila_2:1635043_at:129:607; Interrogation_Position=3777; Antisense; TGAGGAACCAGAGTACCCCACTGTT
>probe:Drosophila_2:1635043_at:708:533; Interrogation_Position=3807; Antisense; GGTGCCGCCACCCAAATCAAAGAAC
>probe:Drosophila_2:1635043_at:231:371; Interrogation_Position=3935; Antisense; GAAGGGTGCCTTCGAGCACTCGATC
>probe:Drosophila_2:1635043_at:723:261; Interrogation_Position=3975; Antisense; CACCAGACCTGCGATTGCGGAAGTA
>probe:Drosophila_2:1635043_at:43:435; Interrogation_Position=4000; Antisense; GAGGGCAGTCAGCAAACATCCTTGG
>probe:Drosophila_2:1635043_at:430:303; Interrogation_Position=4034; Antisense; CCGCCGACAGGGACTTGCTGCAGAA
>probe:Drosophila_2:1635043_at:16:339; Interrogation_Position=4117; Antisense; GCTCTCAGCTACTGCACAGATCTGG
>probe:Drosophila_2:1635043_at:124:635; Interrogation_Position=4154; Antisense; TCGCCTGCTATGTGTACTTGTTCAA
>probe:Drosophila_2:1635043_at:54:149; Interrogation_Position=4169; Antisense; ACTTGTTCAAGGACGCACGCTTGGT
>probe:Drosophila_2:1635043_at:32:273; Interrogation_Position=4200; Antisense; CATTCTGGGCCTTATCATCTACAGG
>probe:Drosophila_2:1635043_at:311:703; Interrogation_Position=4211; Antisense; TTATCATCTACAGGCAGCTGGGCGA
>probe:Drosophila_2:1635043_at:473:297; Interrogation_Position=4267; Antisense; CGCCGCAGGTTCACCGGGAATGGTA

Paste this into a BLAST search page for me
ATCGCCCGAAAAGCCAGAATCTGACGGAGCACGAGTCACCGAAATCGCAATGAGGAACCAGAGTACCCCACTGTTGGTGCCGCCACCCAAATCAAAGAACGAAGGGTGCCTTCGAGCACTCGATCCACCAGACCTGCGATTGCGGAAGTAGAGGGCAGTCAGCAAACATCCTTGGCCGCCGACAGGGACTTGCTGCAGAAGCTCTCAGCTACTGCACAGATCTGGTCGCCTGCTATGTGTACTTGTTCAAACTTGTTCAAGGACGCACGCTTGGTCATTCTGGGCCTTATCATCTACAGGTTATCATCTACAGGCAGCTGGGCGACGCCGCAGGTTCACCGGGAATGGTA

Full Affymetrix probeset data:

Annotations for 1635043_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720