FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635044_at:

>probe:Drosophila_2:1635044_at:442:295; Interrogation_Position=455; Antisense; CGAGATGGCCAACCGCAACGACATT
>probe:Drosophila_2:1635044_at:167:81; Interrogation_Position=520; Antisense; AGGTGTGCATGGACGTCGCCCAGTT
>probe:Drosophila_2:1635044_at:16:475; Interrogation_Position=542; Antisense; GTTCAAGCCCAGTGAGCTCAACGTG
>probe:Drosophila_2:1635044_at:71:223; Interrogation_Position=567; Antisense; AAGGTGGTGGACGACTCCATCTTGG
>probe:Drosophila_2:1635044_at:513:71; Interrogation_Position=607; Antisense; AGGAACGCCAGGACGACCATGGTCA
>probe:Drosophila_2:1635044_at:248:65; Interrogation_Position=625; Antisense; ATGGTCACATCATGCGCCACTTTGT
>probe:Drosophila_2:1635044_at:344:421; Interrogation_Position=684; Antisense; GAGCAAGTGGTCTCGCAGCTGTCGT
>probe:Drosophila_2:1635044_at:671:439; Interrogation_Position=711; Antisense; GATGGCGTGCTCACCGTCAGTATTC
>probe:Drosophila_2:1635044_at:531:205; Interrogation_Position=738; Antisense; AAGCCGCAGGCCGTCGAGGACAAGT
>probe:Drosophila_2:1635044_at:712:553; Interrogation_Position=767; Antisense; GGAGCGCATCATTCAAATTCAGCAA
>probe:Drosophila_2:1635044_at:234:163; Interrogation_Position=781; Antisense; AAATTCAGCAAGTGGGACCCGCTCA
>probe:Drosophila_2:1635044_at:380:75; Interrogation_Position=844; Antisense; AGGAGAACGGAGCACCCAACGGCAA
>probe:Drosophila_2:1635044_at:79:643; Interrogation_Position=910; Antisense; TCATTCCCCTACTTAATTGTTCCTA
>probe:Drosophila_2:1635044_at:139:167; Interrogation_Position=992; Antisense; AAATCCTTTTGTTCACCTGGTGTGG

Paste this into a BLAST search page for me
CGAGATGGCCAACCGCAACGACATTAGGTGTGCATGGACGTCGCCCAGTTGTTCAAGCCCAGTGAGCTCAACGTGAAGGTGGTGGACGACTCCATCTTGGAGGAACGCCAGGACGACCATGGTCAATGGTCACATCATGCGCCACTTTGTGAGCAAGTGGTCTCGCAGCTGTCGTGATGGCGTGCTCACCGTCAGTATTCAAGCCGCAGGCCGTCGAGGACAAGTGGAGCGCATCATTCAAATTCAGCAAAAATTCAGCAAGTGGGACCCGCTCAAGGAGAACGGAGCACCCAACGGCAATCATTCCCCTACTTAATTGTTCCTAAAATCCTTTTGTTCACCTGGTGTGG

Full Affymetrix probeset data:

Annotations for 1635044_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720