FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635045_at:

>probe:Drosophila_2:1635045_at:268:347; Interrogation_Position=1037; Antisense; GCATGATTAACTAATTGCTGTGCAA
>probe:Drosophila_2:1635045_at:416:721; Interrogation_Position=1051; Antisense; TTGCTGTGCAATAAAAACGATGCTT
>probe:Drosophila_2:1635045_at:470:203; Interrogation_Position=532; Antisense; AACCACGGTCTGAATCTTAATGACG
>probe:Drosophila_2:1635045_at:422:259; Interrogation_Position=535; Antisense; CACGGTCTGAATCTTAATGACGTAT
>probe:Drosophila_2:1635045_at:216:283; Interrogation_Position=541; Antisense; CTGAATCTTAATGACGTATATGTGA
>probe:Drosophila_2:1635045_at:114:409; Interrogation_Position=553; Antisense; GACGTATATGTGATTGGTCACAGCT
>probe:Drosophila_2:1635045_at:271:25; Interrogation_Position=558; Antisense; ATATGTGATTGGTCACAGCTTGGGC
>probe:Drosophila_2:1635045_at:390:125; Interrogation_Position=803; Antisense; AGCCCGGCTGCCCTCTGGATGTGAC
>probe:Drosophila_2:1635045_at:271:287; Interrogation_Position=807; Antisense; CGGCTGCCCTCTGGATGTGACTGGA
>probe:Drosophila_2:1635045_at:462:335; Interrogation_Position=809; Antisense; GCTGCCCTCTGGATGTGACTGGAGC
>probe:Drosophila_2:1635045_at:262:321; Interrogation_Position=812; Antisense; GCCCTCTGGATGTGACTGGAGCCTG
>probe:Drosophila_2:1635045_at:550:641; Interrogation_Position=816; Antisense; TCTGGATGTGACTGGAGCCTGCTCC
>probe:Drosophila_2:1635045_at:435:589; Interrogation_Position=818; Antisense; TGGATGTGACTGGAGCCTGCTCCCA
>probe:Drosophila_2:1635045_at:262:595; Interrogation_Position=822; Antisense; TGTGACTGGAGCCTGCTCCCACGGA

Paste this into a BLAST search page for me
GCATGATTAACTAATTGCTGTGCAATTGCTGTGCAATAAAAACGATGCTTAACCACGGTCTGAATCTTAATGACGCACGGTCTGAATCTTAATGACGTATCTGAATCTTAATGACGTATATGTGAGACGTATATGTGATTGGTCACAGCTATATGTGATTGGTCACAGCTTGGGCAGCCCGGCTGCCCTCTGGATGTGACCGGCTGCCCTCTGGATGTGACTGGAGCTGCCCTCTGGATGTGACTGGAGCGCCCTCTGGATGTGACTGGAGCCTGTCTGGATGTGACTGGAGCCTGCTCCTGGATGTGACTGGAGCCTGCTCCCATGTGACTGGAGCCTGCTCCCACGGA

Full Affymetrix probeset data:

Annotations for 1635045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720