FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635046_at:

>probe:Drosophila_2:1635046_at:82:365; Interrogation_Position=1362; Antisense; GAATTTAACCAAAGCTCCCTGTCGG
>probe:Drosophila_2:1635046_at:533:625; Interrogation_Position=1388; Antisense; TGCCCTTACGCGAATCCTGGATGAG
>probe:Drosophila_2:1635046_at:377:121; Interrogation_Position=1414; Antisense; AGCGTTTCATAAGTGCTCTCCACCA
>probe:Drosophila_2:1635046_at:95:261; Interrogation_Position=1434; Antisense; CACCAGGCCCAGTTGAAGTTCCGGA
>probe:Drosophila_2:1635046_at:355:235; Interrogation_Position=1468; Antisense; AATCCGCCCTGGAATTGGCTGTATG
>probe:Drosophila_2:1635046_at:9:573; Interrogation_Position=1484; Antisense; GGCTGTATGGCATGCGGAACAACTT
>probe:Drosophila_2:1635046_at:163:561; Interrogation_Position=1499; Antisense; GGAACAACTTATCGCCGAACCACGA
>probe:Drosophila_2:1635046_at:622:317; Interrogation_Position=1512; Antisense; GCCGAACCACGACTATTTAAACATT
>probe:Drosophila_2:1635046_at:692:355; Interrogation_Position=1539; Antisense; GCACAAACTGAGACGTTAGCCCAAA
>probe:Drosophila_2:1635046_at:427:315; Interrogation_Position=1557; Antisense; GCCCAAAATTTCTTCGTGGCCAATT
>probe:Drosophila_2:1635046_at:627:521; Interrogation_Position=1572; Antisense; GTGGCCAATTCCCTAGATGTCCTGA
>probe:Drosophila_2:1635046_at:230:627; Interrogation_Position=1622; Antisense; TGCCGTGGTATCCTTGGCCAACTTG
>probe:Drosophila_2:1635046_at:103:149; Interrogation_Position=1642; Antisense; ACTTGGTCTACGTCTTATACACTGG
>probe:Drosophila_2:1635046_at:562:509; Interrogation_Position=1665; Antisense; GGAGGATCCAAACGTCAACAAACTT

Paste this into a BLAST search page for me
GAATTTAACCAAAGCTCCCTGTCGGTGCCCTTACGCGAATCCTGGATGAGAGCGTTTCATAAGTGCTCTCCACCACACCAGGCCCAGTTGAAGTTCCGGAAATCCGCCCTGGAATTGGCTGTATGGGCTGTATGGCATGCGGAACAACTTGGAACAACTTATCGCCGAACCACGAGCCGAACCACGACTATTTAAACATTGCACAAACTGAGACGTTAGCCCAAAGCCCAAAATTTCTTCGTGGCCAATTGTGGCCAATTCCCTAGATGTCCTGATGCCGTGGTATCCTTGGCCAACTTGACTTGGTCTACGTCTTATACACTGGGGAGGATCCAAACGTCAACAAACTT

Full Affymetrix probeset data:

Annotations for 1635046_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720