FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635049_at:

>probe:Drosophila_2:1635049_at:347:101; Interrogation_Position=122; Antisense; AGAGAGTTGATTCTGGCTTCGCCAA
>probe:Drosophila_2:1635049_at:672:65; Interrogation_Position=13; Antisense; ATGGTTTACATATGCACTCTTGTGG
>probe:Drosophila_2:1635049_at:691:573; Interrogation_Position=135; Antisense; TGGCTTCGCCAACCCCAATATCGTG
>probe:Drosophila_2:1635049_at:38:263; Interrogation_Position=169; Antisense; CAGCCGTCGGTCGTAACGCAAACAG
>probe:Drosophila_2:1635049_at:9:193; Interrogation_Position=220; Antisense; AACTTTGCATATAGTCCGATGACGC
>probe:Drosophila_2:1635049_at:430:611; Interrogation_Position=239; Antisense; TGACGCAGAGCTGGACCCTCATTGC
>probe:Drosophila_2:1635049_at:363:145; Interrogation_Position=28; Antisense; ACTCTTGTGGTGTTGATCTTTCCCG
>probe:Drosophila_2:1635049_at:120:241; Interrogation_Position=283; Antisense; AATAATGACACCCTCGTCTGGAACC
>probe:Drosophila_2:1635049_at:592:361; Interrogation_Position=311; Antisense; GCAATGACAAATGGCTCACTCGCTA
>probe:Drosophila_2:1635049_at:689:725; Interrogation_Position=40; Antisense; TTGATCTTTCCCGTCTTGTTGTTGG
>probe:Drosophila_2:1635049_at:390:275; Interrogation_Position=54; Antisense; CTTGTTGTTGGGTGCACCATGGGAA
>probe:Drosophila_2:1635049_at:67:355; Interrogation_Position=67; Antisense; GCACCATGGGAAGGGTCGCATCCTA
>probe:Drosophila_2:1635049_at:538:81; Interrogation_Position=78; Antisense; AGGGTCGCATCCTAAGTCTCAGGTG
>probe:Drosophila_2:1635049_at:277:497; Interrogation_Position=93; Antisense; GTCTCAGGTGGAATACATCAGCAAC

Paste this into a BLAST search page for me
AGAGAGTTGATTCTGGCTTCGCCAAATGGTTTACATATGCACTCTTGTGGTGGCTTCGCCAACCCCAATATCGTGCAGCCGTCGGTCGTAACGCAAACAGAACTTTGCATATAGTCCGATGACGCTGACGCAGAGCTGGACCCTCATTGCACTCTTGTGGTGTTGATCTTTCCCGAATAATGACACCCTCGTCTGGAACCGCAATGACAAATGGCTCACTCGCTATTGATCTTTCCCGTCTTGTTGTTGGCTTGTTGTTGGGTGCACCATGGGAAGCACCATGGGAAGGGTCGCATCCTAAGGGTCGCATCCTAAGTCTCAGGTGGTCTCAGGTGGAATACATCAGCAAC

Full Affymetrix probeset data:

Annotations for 1635049_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720