Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635054_at:

>probe:Drosophila_2:1635054_at:438:239; Interrogation_Position=1066; Antisense; AATCAGACAGTTAACGCGCCCTATG
>probe:Drosophila_2:1635054_at:633:453; Interrogation_Position=1129; Antisense; GATAAGGTCTCTGATAAGCCGCGAC
>probe:Drosophila_2:1635054_at:105:175; Interrogation_Position=1163; Antisense; AAACCATGCGACACGAGGAAGCCTT
>probe:Drosophila_2:1635054_at:146:347; Interrogation_Position=612; Antisense; GCATCATTGCAGTTTGCTCTATAGA
>probe:Drosophila_2:1635054_at:272:219; Interrogation_Position=683; Antisense; AAGTGACAGATTTCGGATTTGCCAA
>probe:Drosophila_2:1635054_at:344:249; Interrogation_Position=725; Antisense; CAATGACATTGTGCGGAACTCCGGA
>probe:Drosophila_2:1635054_at:119:487; Interrogation_Position=750; Antisense; GTACCTGCCGCCAGAGATTATCCAA
>probe:Drosophila_2:1635054_at:665:379; Interrogation_Position=777; Antisense; GAAGCCTTACGGAACCAGCGTGGAC
>probe:Drosophila_2:1635054_at:179:143; Interrogation_Position=819; Antisense; ACTGGTCTTTGAATTCGTCGCTGGA
>probe:Drosophila_2:1635054_at:285:573; Interrogation_Position=903; Antisense; GGCGGACTATAAGATGCCCAGTTAT
>probe:Drosophila_2:1635054_at:715:475; Interrogation_Position=923; Antisense; GTTATTTCAGTGGAGCTCTGCGTCA
>probe:Drosophila_2:1635054_at:51:119; Interrogation_Position=936; Antisense; AGCTCTGCGTCATTTGGTGGACCAC
>probe:Drosophila_2:1635054_at:113:619; Interrogation_Position=965; Antisense; TGCAGGTGGATCTCTCGAAGCGTTT
>probe:Drosophila_2:1635054_at:250:379; Interrogation_Position=981; Antisense; GAAGCGTTTTGGCAACCTGATCAAC

Paste this into a BLAST search page for me
AATCAGACAGTTAACGCGCCCTATGGATAAGGTCTCTGATAAGCCGCGACAAACCATGCGACACGAGGAAGCCTTGCATCATTGCAGTTTGCTCTATAGAAAGTGACAGATTTCGGATTTGCCAACAATGACATTGTGCGGAACTCCGGAGTACCTGCCGCCAGAGATTATCCAAGAAGCCTTACGGAACCAGCGTGGACACTGGTCTTTGAATTCGTCGCTGGAGGCGGACTATAAGATGCCCAGTTATGTTATTTCAGTGGAGCTCTGCGTCAAGCTCTGCGTCATTTGGTGGACCACTGCAGGTGGATCTCTCGAAGCGTTTGAAGCGTTTTGGCAACCTGATCAAC

Full Affymetrix probeset data:

Annotations for 1635054_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime