FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635055_at:

>probe:Drosophila_2:1635055_at:720:689; Interrogation_Position=1014; Antisense; TATTGTAAATCGTTGGTTGACCCAC
>probe:Drosophila_2:1635055_at:219:225; Interrogation_Position=455; Antisense; AAGGAGCCTATGGATGCCGTCGGTC
>probe:Drosophila_2:1635055_at:359:501; Interrogation_Position=473; Antisense; GTCGGTCCGAATAAGTTCCAGTCCA
>probe:Drosophila_2:1635055_at:384:339; Interrogation_Position=514; Antisense; GCTCAACCTGGGTCGCAATATTTTC
>probe:Drosophila_2:1635055_at:82:407; Interrogation_Position=552; Antisense; GACTGCTGGGCAATCGTGGCTTCAT
>probe:Drosophila_2:1635055_at:614:545; Interrogation_Position=639; Antisense; GGATCCGAGAGAACTGTGCCCATGG
>probe:Drosophila_2:1635055_at:646:357; Interrogation_Position=672; Antisense; GCAAGCGTCACCACAAACAGAAGTT
>probe:Drosophila_2:1635055_at:275:477; Interrogation_Position=705; Antisense; GTTTTGCCCGTGAGATCATCCGGAA
>probe:Drosophila_2:1635055_at:130:185; Interrogation_Position=773; Antisense; AAAATCCATCCTTGTAAGCACTCCA
>probe:Drosophila_2:1635055_at:239:117; Interrogation_Position=800; Antisense; AGCTTGGATAGCTTCGCTTCGGAGC
>probe:Drosophila_2:1635055_at:174:667; Interrogation_Position=844; Antisense; TACGGATTCCACGACGTCGGAGGCT
>probe:Drosophila_2:1635055_at:678:71; Interrogation_Position=864; Antisense; AGGCTCAGGCCATGGGTTTGCGTCA
>probe:Drosophila_2:1635055_at:443:121; Interrogation_Position=932; Antisense; AGCGTGTGTCGCATCAACTGATTGA
>probe:Drosophila_2:1635055_at:231:275; Interrogation_Position=982; Antisense; CTTCTACTTTTCGATGTGGCCTTAA

Paste this into a BLAST search page for me
TATTGTAAATCGTTGGTTGACCCACAAGGAGCCTATGGATGCCGTCGGTCGTCGGTCCGAATAAGTTCCAGTCCAGCTCAACCTGGGTCGCAATATTTTCGACTGCTGGGCAATCGTGGCTTCATGGATCCGAGAGAACTGTGCCCATGGGCAAGCGTCACCACAAACAGAAGTTGTTTTGCCCGTGAGATCATCCGGAAAAAATCCATCCTTGTAAGCACTCCAAGCTTGGATAGCTTCGCTTCGGAGCTACGGATTCCACGACGTCGGAGGCTAGGCTCAGGCCATGGGTTTGCGTCAAGCGTGTGTCGCATCAACTGATTGACTTCTACTTTTCGATGTGGCCTTAA

Full Affymetrix probeset data:

Annotations for 1635055_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720