FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635056_at:

>probe:Drosophila_2:1635056_at:38:329; Interrogation_Position=377; Antisense; GCGTCTGTGTCCTGATGCGAGATCA
>probe:Drosophila_2:1635056_at:326:37; Interrogation_Position=398; Antisense; ATCATCACTGCTTCTTTACTGGTTG
>probe:Drosophila_2:1635056_at:676:705; Interrogation_Position=413; Antisense; TTACTGGTTGCTGCATCGGTCATGA
>probe:Drosophila_2:1635056_at:161:461; Interrogation_Position=489; Antisense; GATTTCACTAACGTCATCTTCGATA
>probe:Drosophila_2:1635056_at:648:381; Interrogation_Position=573; Antisense; GAACTCTGCCTATTTTAACTCGCTT
>probe:Drosophila_2:1635056_at:180:95; Interrogation_Position=620; Antisense; AGTTGCCCGATATATACGAGCTGGT
>probe:Drosophila_2:1635056_at:113:333; Interrogation_Position=639; Antisense; GCTGGTGTTCACTCTGGTATTCGTC
>probe:Drosophila_2:1635056_at:162:485; Interrogation_Position=679; Antisense; GTATGCGTAGCTACCTATGTGGCTT
>probe:Drosophila_2:1635056_at:170:681; Interrogation_Position=703; Antisense; TATGATCAGTGGTCTCGTGGCTATT
>probe:Drosophila_2:1635056_at:402:641; Interrogation_Position=761; Antisense; TTGACCGAAAACTGCGCCGAAACTT
>probe:Drosophila_2:1635056_at:44:251; Interrogation_Position=786; Antisense; CAAGACGTTCTTGGGCAGGCGAATG
>probe:Drosophila_2:1635056_at:102:615; Interrogation_Position=809; Antisense; TGAAGTGGACCTGGATCTCCGGATT
>probe:Drosophila_2:1635056_at:347:121; Interrogation_Position=845; Antisense; AGCTGGACCACGACGGATTTGATCT
>probe:Drosophila_2:1635056_at:673:39; Interrogation_Position=866; Antisense; ATCTGGATCCCGACAACGAACGTGT

Paste this into a BLAST search page for me
GCGTCTGTGTCCTGATGCGAGATCAATCATCACTGCTTCTTTACTGGTTGTTACTGGTTGCTGCATCGGTCATGAGATTTCACTAACGTCATCTTCGATAGAACTCTGCCTATTTTAACTCGCTTAGTTGCCCGATATATACGAGCTGGTGCTGGTGTTCACTCTGGTATTCGTCGTATGCGTAGCTACCTATGTGGCTTTATGATCAGTGGTCTCGTGGCTATTTTGACCGAAAACTGCGCCGAAACTTCAAGACGTTCTTGGGCAGGCGAATGTGAAGTGGACCTGGATCTCCGGATTAGCTGGACCACGACGGATTTGATCTATCTGGATCCCGACAACGAACGTGT

Full Affymetrix probeset data:

Annotations for 1635056_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720