FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635060_at:

>probe:Drosophila_2:1635060_at:567:229; Interrogation_Position=101; Antisense; AATGTGATTATAAACGGCGACTGCA
>probe:Drosophila_2:1635060_at:25:31; Interrogation_Position=110; Antisense; ATAAACGGCGACTGCAAAGTTTGCA
>probe:Drosophila_2:1635060_at:638:169; Interrogation_Position=125; Antisense; AAAGTTTGCAATATACGCGGCGATT
>probe:Drosophila_2:1635060_at:709:27; Interrogation_Position=137; Antisense; ATACGCGGCGATTAGAATGTGGAAA
>probe:Drosophila_2:1635060_at:218:165; Interrogation_Position=15; Antisense; AAATCACAAACAATATGAAGCTGCT
>probe:Drosophila_2:1635060_at:501:239; Interrogation_Position=175; Antisense; TAAACTAAAGTCACTGAAACACCAA
>probe:Drosophila_2:1635060_at:374:55; Interrogation_Position=29; Antisense; ATGAAGCTGCTCTCGATTACTTTTC
>probe:Drosophila_2:1635060_at:80:337; Interrogation_Position=37; Antisense; GCTCTCGATTACTTTTCTCTTCGGA
>probe:Drosophila_2:1635060_at:672:455; Interrogation_Position=43; Antisense; GATTACTTTTCTCTTCGGACTTTTG
>probe:Drosophila_2:1635060_at:433:665; Interrogation_Position=46; Antisense; TACTTTTCTCTTCGGACTTTTGGCT
>probe:Drosophila_2:1635060_at:665:635; Interrogation_Position=57; Antisense; TCGGACTTTTGGCTTTGGCTAGTGC
>probe:Drosophila_2:1635060_at:605:691; Interrogation_Position=64; Antisense; TTTGGCTTTGGCTAGTGCCAATCCC
>probe:Drosophila_2:1635060_at:279:729; Interrogation_Position=71; Antisense; TTGGCTAGTGCCAATCCCCTGAGTC
>probe:Drosophila_2:1635060_at:259:303; Interrogation_Position=86; Antisense; CCCCTGAGTCCTGGCAATGTGATTA

Paste this into a BLAST search page for me
AATGTGATTATAAACGGCGACTGCAATAAACGGCGACTGCAAAGTTTGCAAAAGTTTGCAATATACGCGGCGATTATACGCGGCGATTAGAATGTGGAAAAAATCACAAACAATATGAAGCTGCTTAAACTAAAGTCACTGAAACACCAAATGAAGCTGCTCTCGATTACTTTTCGCTCTCGATTACTTTTCTCTTCGGAGATTACTTTTCTCTTCGGACTTTTGTACTTTTCTCTTCGGACTTTTGGCTTCGGACTTTTGGCTTTGGCTAGTGCTTTGGCTTTGGCTAGTGCCAATCCCTTGGCTAGTGCCAATCCCCTGAGTCCCCCTGAGTCCTGGCAATGTGATTA

Full Affymetrix probeset data:

Annotations for 1635060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720