FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635063_at:

>probe:Drosophila_2:1635063_at:730:359; Interrogation_Position=1281; Antisense; GCAAGCCCGATTTCCGTGATATGGA
>probe:Drosophila_2:1635063_at:136:409; Interrogation_Position=1334; Antisense; GACGATGGCTATCCCACATTTGACT
>probe:Drosophila_2:1635063_at:120:19; Interrogation_Position=1351; Antisense; ATTTGACTACCAGAACGCGACCATC
>probe:Drosophila_2:1635063_at:715:413; Interrogation_Position=1369; Antisense; GACCATCAAGCGTGAGATCGACGAT
>probe:Drosophila_2:1635063_at:39:55; Interrogation_Position=1398; Antisense; ATGAGGAGAAGTACCGGCCGCCGCC
>probe:Drosophila_2:1635063_at:643:161; Interrogation_Position=1431; Antisense; ACAATATGTTCAGTGTGCCGCCGCC
>probe:Drosophila_2:1635063_at:316:559; Interrogation_Position=1472; Antisense; GGAAATGCCAGCACGAATCCCAATC
>probe:Drosophila_2:1635063_at:662:161; Interrogation_Position=1500; Antisense; ACAATGGCCAGCAGAGCTCCGGCGA
>probe:Drosophila_2:1635063_at:490:373; Interrogation_Position=1582; Antisense; GAAGTCAGACGTCTGTGAGTCGCAA
>probe:Drosophila_2:1635063_at:90:149; Interrogation_Position=1606; Antisense; ACTATTTATTCATTCGACTCCGAGG
>probe:Drosophila_2:1635063_at:207:301; Interrogation_Position=1635; Antisense; CCAATCCTGGAGAGCCTAACCGTAG
>probe:Drosophila_2:1635063_at:268:115; Interrogation_Position=1647; Antisense; AGCCTAACCGTAGCTATCCATTTTA
>probe:Drosophila_2:1635063_at:681:409; Interrogation_Position=1734; Antisense; GACCGCTAAACGCAGAATCCGCTAA
>probe:Drosophila_2:1635063_at:183:235; Interrogation_Position=1749; Antisense; AATCCGCTAATGTGTGCGTAGCTTA

Paste this into a BLAST search page for me
GCAAGCCCGATTTCCGTGATATGGAGACGATGGCTATCCCACATTTGACTATTTGACTACCAGAACGCGACCATCGACCATCAAGCGTGAGATCGACGATATGAGGAGAAGTACCGGCCGCCGCCACAATATGTTCAGTGTGCCGCCGCCGGAAATGCCAGCACGAATCCCAATCACAATGGCCAGCAGAGCTCCGGCGAGAAGTCAGACGTCTGTGAGTCGCAAACTATTTATTCATTCGACTCCGAGGCCAATCCTGGAGAGCCTAACCGTAGAGCCTAACCGTAGCTATCCATTTTAGACCGCTAAACGCAGAATCCGCTAAAATCCGCTAATGTGTGCGTAGCTTA

Full Affymetrix probeset data:

Annotations for 1635063_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720