Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635065_at:

>probe:Drosophila_2:1635065_at:576:423; Interrogation_Position=1006; Antisense; GAGAGCCTACCTTATGGAACCGTTT
>probe:Drosophila_2:1635065_at:78:667; Interrogation_Position=1030; Antisense; TACAGATACGGCTCAGCTGCGGGCA
>probe:Drosophila_2:1635065_at:557:587; Interrogation_Position=1071; Antisense; TGGAGCCACCATCGATTGGGCATAC
>probe:Drosophila_2:1635065_at:564:501; Interrogation_Position=1145; Antisense; GTCGATATGGTTTTATCCTGCCACC
>probe:Drosophila_2:1635065_at:686:627; Interrogation_Position=1163; Antisense; TGCCACCGGTGCACATTATTCCAAA
>probe:Drosophila_2:1635065_at:107:237; Interrogation_Position=1203; Antisense; AATCGGCATTGCTGCCCTATTAGAA
>probe:Drosophila_2:1635065_at:153:83; Interrogation_Position=1229; Antisense; AGTGTAAAGACCTCGGCTATCTCGG
>probe:Drosophila_2:1635065_at:210:39; Interrogation_Position=1247; Antisense; ATCTCGGGCTTAAGAGCGCGCTGTA
>probe:Drosophila_2:1635065_at:521:551; Interrogation_Position=724; Antisense; GGAGCAGACCCCAATCGAAACTACG
>probe:Drosophila_2:1635065_at:689:713; Interrogation_Position=777; Antisense; TTCTTCGAATCCCTGTGCTGAGGAT
>probe:Drosophila_2:1635065_at:295:235; Interrogation_Position=834; Antisense; AATCCAGGCCATGTCTGAGTTTGTA
>probe:Drosophila_2:1635065_at:190:165; Interrogation_Position=875; Antisense; AAATCAATGTTTTGCTCGCGTTCCA
>probe:Drosophila_2:1635065_at:104:471; Interrogation_Position=894; Antisense; GTTCCACTCGTATAGTCAGCTTTTG
>probe:Drosophila_2:1635065_at:252:551; Interrogation_Position=945; Antisense; GGAGTTTCCTCCCAATTTTGATGAT

Paste this into a BLAST search page for me
GAGAGCCTACCTTATGGAACCGTTTTACAGATACGGCTCAGCTGCGGGCATGGAGCCACCATCGATTGGGCATACGTCGATATGGTTTTATCCTGCCACCTGCCACCGGTGCACATTATTCCAAAAATCGGCATTGCTGCCCTATTAGAAAGTGTAAAGACCTCGGCTATCTCGGATCTCGGGCTTAAGAGCGCGCTGTAGGAGCAGACCCCAATCGAAACTACGTTCTTCGAATCCCTGTGCTGAGGATAATCCAGGCCATGTCTGAGTTTGTAAAATCAATGTTTTGCTCGCGTTCCAGTTCCACTCGTATAGTCAGCTTTTGGGAGTTTCCTCCCAATTTTGATGAT

Full Affymetrix probeset data:

Annotations for 1635065_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime