Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635066_at:

>probe:Drosophila_2:1635066_at:144:727; Interrogation_Position=4257; Antisense; TTGTTCCAAATTCCCAGCAGGCTAA
>probe:Drosophila_2:1635066_at:730:173; Interrogation_Position=4285; Antisense; AAACCAATGGACTGTGGCGGACCTT
>probe:Drosophila_2:1635066_at:654:593; Interrogation_Position=4297; Antisense; TGTGGCGGACCTTAACCCGAATCAC
>probe:Drosophila_2:1635066_at:19:567; Interrogation_Position=4335; Antisense; GGCACGCCAGTCTAGAGTCTAACGG
>probe:Drosophila_2:1635066_at:110:125; Interrogation_Position=4407; Antisense; AGCGCCAACTGTCACGGCAGAACAG
>probe:Drosophila_2:1635066_at:498:333; Interrogation_Position=4446; Antisense; GCTGTCGCCTCATGTAAGCCGTTAG
>probe:Drosophila_2:1635066_at:149:203; Interrogation_Position=4461; Antisense; AAGCCGTTAGCCGTAATCCGTAATG
>probe:Drosophila_2:1635066_at:434:425; Interrogation_Position=4487; Antisense; GAGAGGCGTAATCCGTACTCCACAT
>probe:Drosophila_2:1635066_at:333:489; Interrogation_Position=4501; Antisense; GTACTCCACATACTCAGCGCAAAGA
>probe:Drosophila_2:1635066_at:565:377; Interrogation_Position=4561; Antisense; GAAGCGTTTTGTTGCTGTAGCTCGT
>probe:Drosophila_2:1635066_at:670:599; Interrogation_Position=4599; Antisense; TGTTAATTGTAAGCCGGCGTACACA
>probe:Drosophila_2:1635066_at:53:329; Interrogation_Position=4615; Antisense; GCGTACACACTCACACAGGGTTAGA
>probe:Drosophila_2:1635066_at:622:201; Interrogation_Position=4645; Antisense; AACCGGATGGAAACTCACACGCAGA
>probe:Drosophila_2:1635066_at:616:105; Interrogation_Position=4667; Antisense; AGACAACGAAGCGTCGCCGGCTAAA

Paste this into a BLAST search page for me
TTGTTCCAAATTCCCAGCAGGCTAAAAACCAATGGACTGTGGCGGACCTTTGTGGCGGACCTTAACCCGAATCACGGCACGCCAGTCTAGAGTCTAACGGAGCGCCAACTGTCACGGCAGAACAGGCTGTCGCCTCATGTAAGCCGTTAGAAGCCGTTAGCCGTAATCCGTAATGGAGAGGCGTAATCCGTACTCCACATGTACTCCACATACTCAGCGCAAAGAGAAGCGTTTTGTTGCTGTAGCTCGTTGTTAATTGTAAGCCGGCGTACACAGCGTACACACTCACACAGGGTTAGAAACCGGATGGAAACTCACACGCAGAAGACAACGAAGCGTCGCCGGCTAAA

Full Affymetrix probeset data:

Annotations for 1635066_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime