FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635067_at:

>probe:Drosophila_2:1635067_at:28:657; Interrogation_Position=110; Antisense; TAATCCGGTGCTGTGTGATCCTAAC
>probe:Drosophila_2:1635067_at:312:449; Interrogation_Position=126; Antisense; GATCCTAACGGCTGTATGCTGCTAC
>probe:Drosophila_2:1635067_at:536:51; Interrogation_Position=141; Antisense; ATGCTGCTACTTGGCCTGGATGGTC
>probe:Drosophila_2:1635067_at:671:441; Interrogation_Position=159; Antisense; GATGGTCACCTTCGTGATGCAGTTG
>probe:Drosophila_2:1635067_at:720:445; Interrogation_Position=174; Antisense; GATGCAGTTGAATCCACTGACCGGA
>probe:Drosophila_2:1635067_at:291:209; Interrogation_Position=19; Antisense; AAGCACGTGGCATTCATGGTCATCA
>probe:Drosophila_2:1635067_at:234:609; Interrogation_Position=191; Antisense; TGACCGGACCGCGAGCCAAACAGAA
>probe:Drosophila_2:1635067_at:188:189; Interrogation_Position=209; Antisense; AACAGAAGATTATCCTCGGCATGAT
>probe:Drosophila_2:1635067_at:88:569; Interrogation_Position=226; Antisense; GGCATGATAACCTACTGGCCCAGGT
>probe:Drosophila_2:1635067_at:431:301; Interrogation_Position=244; Antisense; CCCAGGTCCATTATCCACGATGAAA
>probe:Drosophila_2:1635067_at:128:31; Interrogation_Position=40; Antisense; ATCACCGTTTTCTGGCTACTATTCG
>probe:Drosophila_2:1635067_at:218:147; Interrogation_Position=57; Antisense; ACTATTCGCCATCATTGGGTTCCTG
>probe:Drosophila_2:1635067_at:53:461; Interrogation_Position=75; Antisense; GTTCCTGGTGTCCTACCGATACGAG
>probe:Drosophila_2:1635067_at:250:671; Interrogation_Position=94; Antisense; TACGAGGAGCGTGGTCTAATCCGGT

Paste this into a BLAST search page for me
TAATCCGGTGCTGTGTGATCCTAACGATCCTAACGGCTGTATGCTGCTACATGCTGCTACTTGGCCTGGATGGTCGATGGTCACCTTCGTGATGCAGTTGGATGCAGTTGAATCCACTGACCGGAAAGCACGTGGCATTCATGGTCATCATGACCGGACCGCGAGCCAAACAGAAAACAGAAGATTATCCTCGGCATGATGGCATGATAACCTACTGGCCCAGGTCCCAGGTCCATTATCCACGATGAAAATCACCGTTTTCTGGCTACTATTCGACTATTCGCCATCATTGGGTTCCTGGTTCCTGGTGTCCTACCGATACGAGTACGAGGAGCGTGGTCTAATCCGGT

Full Affymetrix probeset data:

Annotations for 1635067_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720