FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635070_at:

>probe:Drosophila_2:1635070_at:143:613; Interrogation_Position=1291; Antisense; TGAAGAACGTTTCCTGGGACTCGGA
>probe:Drosophila_2:1635070_at:632:585; Interrogation_Position=1338; Antisense; TGGACATATCAGACCTGCCACGAAT
>probe:Drosophila_2:1635070_at:72:247; Interrogation_Position=1360; Antisense; AATTCGGCTTCTATCAGACCTCGGA
>probe:Drosophila_2:1635070_at:572:151; Interrogation_Position=1398; Antisense; ACATTTGGTGATCGCTTCGGTGTCG
>probe:Drosophila_2:1635070_at:337:533; Interrogation_Position=1416; Antisense; GGTGTCGACTTCTTTATACGCCAGT
>probe:Drosophila_2:1635070_at:281:381; Interrogation_Position=1466; Antisense; GAACGCCAAGTTCCTCAAACTGGTG
>probe:Drosophila_2:1635070_at:604:177; Interrogation_Position=1482; Antisense; AAACTGGTGGTGTCCGCCACAAATG
>probe:Drosophila_2:1635070_at:668:61; Interrogation_Position=1540; Antisense; ATGTGTTGTACGTGCACGGTTCCAT
>probe:Drosophila_2:1635070_at:669:305; Interrogation_Position=1570; Antisense; CCTGGCATGCTTTGGGCTTGGTCAA
>probe:Drosophila_2:1635070_at:31:265; Interrogation_Position=1606; Antisense; CAGCACTTCCTACCATTTACATAGA
>probe:Drosophila_2:1635070_at:707:143; Interrogation_Position=1642; Antisense; ACTGCGCCAATATGTATGAGCCGGT
>probe:Drosophila_2:1635070_at:15:583; Interrogation_Position=1690; Antisense; TGGCCGCTCGCAACAAGATACTCAA
>probe:Drosophila_2:1635070_at:697:177; Interrogation_Position=1725; Antisense; AAACTACTGGATGGCTACACCTCGG
>probe:Drosophila_2:1635070_at:239:157; Interrogation_Position=1741; Antisense; ACACCTCGGCGTTAATCTGATGGAA

Paste this into a BLAST search page for me
TGAAGAACGTTTCCTGGGACTCGGATGGACATATCAGACCTGCCACGAATAATTCGGCTTCTATCAGACCTCGGAACATTTGGTGATCGCTTCGGTGTCGGGTGTCGACTTCTTTATACGCCAGTGAACGCCAAGTTCCTCAAACTGGTGAAACTGGTGGTGTCCGCCACAAATGATGTGTTGTACGTGCACGGTTCCATCCTGGCATGCTTTGGGCTTGGTCAACAGCACTTCCTACCATTTACATAGAACTGCGCCAATATGTATGAGCCGGTTGGCCGCTCGCAACAAGATACTCAAAAACTACTGGATGGCTACACCTCGGACACCTCGGCGTTAATCTGATGGAA

Full Affymetrix probeset data:

Annotations for 1635070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720