FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635072_at:

>probe:Drosophila_2:1635072_at:535:537; Interrogation_Position=542; Antisense; GGATAAACCATACCCAAACCGATGC
>probe:Drosophila_2:1635072_at:316:587; Interrogation_Position=580; Antisense; TGGATGGCAGTATCACTGATCTCCA
>probe:Drosophila_2:1635072_at:596:259; Interrogation_Position=623; Antisense; CACGACTACTCCAACCGGATGAATA
>probe:Drosophila_2:1635072_at:414:547; Interrogation_Position=639; Antisense; GGATGAATACCCATCTCTCTCTGTA
>probe:Drosophila_2:1635072_at:166:271; Interrogation_Position=650; Antisense; CATCTCTCTCTGTACACTTATTGTT
>probe:Drosophila_2:1635072_at:367:3; Interrogation_Position=669; Antisense; ATTGTTAAGCACACCGCTCTTAGTC
>probe:Drosophila_2:1635072_at:200:293; Interrogation_Position=704; Antisense; CGATACGAACACGATCCTGATCTTG
>probe:Drosophila_2:1635072_at:718:603; Interrogation_Position=721; Antisense; TGATCTTGGGTCCATGTCCATATCC
>probe:Drosophila_2:1635072_at:523:23; Interrogation_Position=740; Antisense; ATATCCTCTGGACATTTTCCAACGC
>probe:Drosophila_2:1635072_at:253:15; Interrogation_Position=753; Antisense; ATTTTCCAACGCACTCAGCAATATA
>probe:Drosophila_2:1635072_at:265:423; Interrogation_Position=845; Antisense; GAGAACTCTTTCAATACTTCCCATC
>probe:Drosophila_2:1635072_at:53:721; Interrogation_Position=882; Antisense; TTCCTCTTCTTTACATCTATCACTA
>probe:Drosophila_2:1635072_at:656:37; Interrogation_Position=919; Antisense; ATCTATCACTATCTGGCATATCGCC
>probe:Drosophila_2:1635072_at:607:95; Interrogation_Position=946; Antisense; AGATATGCCCTGTCAACCTGTAAAT

Paste this into a BLAST search page for me
GGATAAACCATACCCAAACCGATGCTGGATGGCAGTATCACTGATCTCCACACGACTACTCCAACCGGATGAATAGGATGAATACCCATCTCTCTCTGTACATCTCTCTCTGTACACTTATTGTTATTGTTAAGCACACCGCTCTTAGTCCGATACGAACACGATCCTGATCTTGTGATCTTGGGTCCATGTCCATATCCATATCCTCTGGACATTTTCCAACGCATTTTCCAACGCACTCAGCAATATAGAGAACTCTTTCAATACTTCCCATCTTCCTCTTCTTTACATCTATCACTAATCTATCACTATCTGGCATATCGCCAGATATGCCCTGTCAACCTGTAAAT

Full Affymetrix probeset data:

Annotations for 1635072_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720