FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635073_at:

>probe:Drosophila_2:1635073_at:177:555; Interrogation_Position=1022; Antisense; GGAGCCTCTGCTTCAGCCAGTGCCA
>probe:Drosophila_2:1635073_at:498:71; Interrogation_Position=1063; Antisense; AGGCGGCGGCTATCATGGCTAGTCT
>probe:Drosophila_2:1635073_at:509:571; Interrogation_Position=1070; Antisense; GGCTATCATGGCTAGTCTGGATTAC
>probe:Drosophila_2:1635073_at:40:499; Interrogation_Position=1084; Antisense; GTCTGGATTACCCAAAGCCCAATAT
>probe:Drosophila_2:1635073_at:671:111; Interrogation_Position=1099; Antisense; AGCCCAATATACCTGTAATTCTCCC
>probe:Drosophila_2:1635073_at:633:129; Interrogation_Position=1109; Antisense; ACCTGTAATTCTCCCAGTGGCTTAA
>probe:Drosophila_2:1635073_at:320:73; Interrogation_Position=625; Antisense; AGGAATCGGCGGATCCGGTAGCTCT
>probe:Drosophila_2:1635073_at:63:537; Interrogation_Position=641; Antisense; GGTAGCTCTGCATCATCTTCAGTTG
>probe:Drosophila_2:1635073_at:231:347; Interrogation_Position=650; Antisense; GCATCATCTTCAGTTGGAGTTATTG
>probe:Drosophila_2:1635073_at:165:149; Interrogation_Position=834; Antisense; ACTTTGGTGGTGGTCTTAGCCACAA
>probe:Drosophila_2:1635073_at:133:707; Interrogation_Position=849; Antisense; TTAGCCACAAGCACAAAGGCCATGG
>probe:Drosophila_2:1635073_at:268:581; Interrogation_Position=934; Antisense; TGGCGGCTACGGAATTGGACCTGCA
>probe:Drosophila_2:1635073_at:44:363; Interrogation_Position=945; Antisense; GAATTGGACCTGCAGTCTCCTTAGG
>probe:Drosophila_2:1635073_at:534:87; Interrogation_Position=958; Antisense; AGTCTCCTTAGGTGGCGGACCAGGC

Paste this into a BLAST search page for me
GGAGCCTCTGCTTCAGCCAGTGCCAAGGCGGCGGCTATCATGGCTAGTCTGGCTATCATGGCTAGTCTGGATTACGTCTGGATTACCCAAAGCCCAATATAGCCCAATATACCTGTAATTCTCCCACCTGTAATTCTCCCAGTGGCTTAAAGGAATCGGCGGATCCGGTAGCTCTGGTAGCTCTGCATCATCTTCAGTTGGCATCATCTTCAGTTGGAGTTATTGACTTTGGTGGTGGTCTTAGCCACAATTAGCCACAAGCACAAAGGCCATGGTGGCGGCTACGGAATTGGACCTGCAGAATTGGACCTGCAGTCTCCTTAGGAGTCTCCTTAGGTGGCGGACCAGGC

Full Affymetrix probeset data:

Annotations for 1635073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720