Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635075_at:

>probe:Drosophila_2:1635075_at:378:713; Interrogation_Position=123; Antisense; TTCGTTGAAAACACCATTGCCAGCA
>probe:Drosophila_2:1635075_at:220:503; Interrogation_Position=178; Antisense; GTCCCTACTGCACGATGGCCAAAGA
>probe:Drosophila_2:1635075_at:615:555; Interrogation_Position=224; Antisense; GGACGCCACCATAATAGAACTCGAT
>probe:Drosophila_2:1635075_at:48:553; Interrogation_Position=249; Antisense; GGAAATCCCGATGGCAACGAAATTC
>probe:Drosophila_2:1635075_at:187:471; Interrogation_Position=279; Antisense; GTTCTGGGCGAGATTACCGGTGCCA
>probe:Drosophila_2:1635075_at:115:303; Interrogation_Position=313; Antisense; CCCGCGTCTTTATCGATGGCAAATT
>probe:Drosophila_2:1635075_at:221:7; Interrogation_Position=335; Antisense; ATTCATTGGCGGTGGCACTGACATC
>probe:Drosophila_2:1635075_at:355:229; Interrogation_Position=365; Antisense; AATGTTCGAGACAGGAGCTCTGCAA
>probe:Drosophila_2:1635075_at:521:163; Interrogation_Position=403; Antisense; AAATAGTGTTCTTACTCTGTTCAGA
>probe:Drosophila_2:1635075_at:258:281; Interrogation_Position=417; Antisense; CTCTGTTCAGAACTCCGTTTTATGT
>probe:Drosophila_2:1635075_at:598:629; Interrogation_Position=43; Antisense; TCCTGGATTTCGAGCTTATGGGTGC
>probe:Drosophila_2:1635075_at:575:705; Interrogation_Position=58; Antisense; TTATGGGTGCAGTTGGATCCGCTTT
>probe:Drosophila_2:1635075_at:260:609; Interrogation_Position=82; Antisense; TGAGATCCCCAATAGTCGACATGTC
>probe:Drosophila_2:1635075_at:410:401; Interrogation_Position=99; Antisense; GACATGTCCACCAAGCAGGCGAAAT

Paste this into a BLAST search page for me
TTCGTTGAAAACACCATTGCCAGCAGTCCCTACTGCACGATGGCCAAAGAGGACGCCACCATAATAGAACTCGATGGAAATCCCGATGGCAACGAAATTCGTTCTGGGCGAGATTACCGGTGCCACCCGCGTCTTTATCGATGGCAAATTATTCATTGGCGGTGGCACTGACATCAATGTTCGAGACAGGAGCTCTGCAAAAATAGTGTTCTTACTCTGTTCAGACTCTGTTCAGAACTCCGTTTTATGTTCCTGGATTTCGAGCTTATGGGTGCTTATGGGTGCAGTTGGATCCGCTTTTGAGATCCCCAATAGTCGACATGTCGACATGTCCACCAAGCAGGCGAAAT

Full Affymetrix probeset data:

Annotations for 1635075_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime