FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635076_at:

>probe:Drosophila_2:1635076_at:389:369; Interrogation_Position=373; Antisense; GAATGCGCCAAGATGTTCGCCAAGG
>probe:Drosophila_2:1635076_at:295:665; Interrogation_Position=425; Antisense; TACAGCGTTCTGTGGCGGTGCCCAA
>probe:Drosophila_2:1635076_at:402:125; Interrogation_Position=467; Antisense; AGCCGGTCAGCCTGGAGCAACAAAA
>probe:Drosophila_2:1635076_at:693:485; Interrogation_Position=557; Antisense; GTAGCAATGCCTACCCTGTGCAGGT
>probe:Drosophila_2:1635076_at:61:721; Interrogation_Position=583; Antisense; TTGCCAGTCTTTCCCGATACGGATT
>probe:Drosophila_2:1635076_at:437:21; Interrogation_Position=615; Antisense; ATATAGCTTCGTCCAGATGAGTTTT
>probe:Drosophila_2:1635076_at:52:441; Interrogation_Position=630; Antisense; GATGAGTTTTGATAATCCACCCCAA
>probe:Drosophila_2:1635076_at:335:145; Interrogation_Position=680; Antisense; ACTGCGGAAGCTGTCTGATCAACTT
>probe:Drosophila_2:1635076_at:583:651; Interrogation_Position=698; Antisense; TCAACTTCAGTTTCGTCCAGGACAT
>probe:Drosophila_2:1635076_at:100:75; Interrogation_Position=716; Antisense; AGGACATTGCGGACTCTACCGAAAA
>probe:Drosophila_2:1635076_at:495:221; Interrogation_Position=739; Antisense; AAGGTTTACGTATCCGACCATCGCT
>probe:Drosophila_2:1635076_at:175:511; Interrogation_Position=800; Antisense; GTGAGGGTTACATACTCCGCGAGGA
>probe:Drosophila_2:1635076_at:445:367; Interrogation_Position=825; Antisense; GAATGACGCCATCTTTTACGTTGGT
>probe:Drosophila_2:1635076_at:182:479; Interrogation_Position=895; Antisense; GTTTCGGCTAACAAGTTTCTGCTGA

Paste this into a BLAST search page for me
GAATGCGCCAAGATGTTCGCCAAGGTACAGCGTTCTGTGGCGGTGCCCAAAGCCGGTCAGCCTGGAGCAACAAAAGTAGCAATGCCTACCCTGTGCAGGTTTGCCAGTCTTTCCCGATACGGATTATATAGCTTCGTCCAGATGAGTTTTGATGAGTTTTGATAATCCACCCCAAACTGCGGAAGCTGTCTGATCAACTTTCAACTTCAGTTTCGTCCAGGACATAGGACATTGCGGACTCTACCGAAAAAAGGTTTACGTATCCGACCATCGCTGTGAGGGTTACATACTCCGCGAGGAGAATGACGCCATCTTTTACGTTGGTGTTTCGGCTAACAAGTTTCTGCTGA

Full Affymetrix probeset data:

Annotations for 1635076_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720