Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635078_at:

>probe:Drosophila_2:1635078_at:444:383; Interrogation_Position=4237; Antisense; GAACTCAGTAACGTTTTTGAATCAC
>probe:Drosophila_2:1635078_at:259:349; Interrogation_Position=4296; Antisense; GCAGAGGGACAGTGCGTTTCACAAT
>probe:Drosophila_2:1635078_at:510:241; Interrogation_Position=4336; Antisense; AATAGCATTTATTCATTCGGTTCGA
>probe:Drosophila_2:1635078_at:198:537; Interrogation_Position=4354; Antisense; GGTTCGAAGAACACAATTTCCCATT
>probe:Drosophila_2:1635078_at:624:627; Interrogation_Position=4371; Antisense; TTCCCATTTGACAACTTTTTGCGGT
>probe:Drosophila_2:1635078_at:342:329; Interrogation_Position=4391; Antisense; GCGGTAAGTTCGATTACATATCCTA
>probe:Drosophila_2:1635078_at:408:187; Interrogation_Position=4422; Antisense; AACAGCTGGCTGAATTCGAAATTAT
>probe:Drosophila_2:1635078_at:259:15; Interrogation_Position=4442; Antisense; ATTATTTGACAATCGCCAACAGTTG
>probe:Drosophila_2:1635078_at:159:153; Interrogation_Position=4460; Antisense; ACAGTTGGCCATCATTTGTTCCGAA
>probe:Drosophila_2:1635078_at:558:463; Interrogation_Position=4493; Antisense; GATTGTTACTTGTGAAACGCGCTGC
>probe:Drosophila_2:1635078_at:469:391; Interrogation_Position=4506; Antisense; GAAACGCGCTGCACCGTATATATAA
>probe:Drosophila_2:1635078_at:254:199; Interrogation_Position=4675; Antisense; AACGATATGGCTAAACTCGAGTTGA
>probe:Drosophila_2:1635078_at:204:675; Interrogation_Position=4739; Antisense; TATGTGTGTACGTGCTATATAAGAT
>probe:Drosophila_2:1635078_at:706:663; Interrogation_Position=4785; Antisense; TACACGTAAACCGAAATTGACTCAA

Paste this into a BLAST search page for me
GAACTCAGTAACGTTTTTGAATCACGCAGAGGGACAGTGCGTTTCACAATAATAGCATTTATTCATTCGGTTCGAGGTTCGAAGAACACAATTTCCCATTTTCCCATTTGACAACTTTTTGCGGTGCGGTAAGTTCGATTACATATCCTAAACAGCTGGCTGAATTCGAAATTATATTATTTGACAATCGCCAACAGTTGACAGTTGGCCATCATTTGTTCCGAAGATTGTTACTTGTGAAACGCGCTGCGAAACGCGCTGCACCGTATATATAAAACGATATGGCTAAACTCGAGTTGATATGTGTGTACGTGCTATATAAGATTACACGTAAACCGAAATTGACTCAA

Full Affymetrix probeset data:

Annotations for 1635078_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime