FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635079_at:

>probe:Drosophila_2:1635079_at:594:471; Interrogation_Position=1408; Antisense; GTTCGATATTCGCTATGTAATCCTG
>probe:Drosophila_2:1635079_at:573:181; Interrogation_Position=1436; Antisense; AAAAGCGTCAAACCCCTGAAGGCAT
>probe:Drosophila_2:1635079_at:74:563; Interrogation_Position=1470; Antisense; GGAAGTTCTTCCTGCGTTTCGCAAA
>probe:Drosophila_2:1635079_at:456:649; Interrogation_Position=1503; Antisense; TCACGCTGGATCACTTCGATGACTA
>probe:Drosophila_2:1635079_at:479:55; Interrogation_Position=1547; Antisense; ATGAACTACCAGACGGAGGCGCAGC
>probe:Drosophila_2:1635079_at:631:69; Interrogation_Position=1563; Antisense; AGGCGCAGCTGCATCACGTCAAGTG
>probe:Drosophila_2:1635079_at:107:31; Interrogation_Position=1626; Antisense; ATAACGATTGGTCGGCTCTGGAGCA
>probe:Drosophila_2:1635079_at:100:39; Interrogation_Position=1655; Antisense; ATCTGTAGCATGCTGCTCGAGGTGC
>probe:Drosophila_2:1635079_at:495:435; Interrogation_Position=1673; Antisense; GAGGTGCTTCAGTGCGCCAGTCAAG
>probe:Drosophila_2:1635079_at:569:239; Interrogation_Position=1731; Antisense; AATCACGAGCTCTTTACGCAGCCGA
>probe:Drosophila_2:1635079_at:272:587; Interrogation_Position=1794; Antisense; TGGAGCCCCAGTTGCTGGAAATCAA
>probe:Drosophila_2:1635079_at:435:195; Interrogation_Position=1817; Antisense; AACTGGACTCCGGACTGCAAACGCG
>probe:Drosophila_2:1635079_at:689:165; Interrogation_Position=1903; Antisense; AAACGACGATAGCTTCCGGGTACTG
>probe:Drosophila_2:1635079_at:375:669; Interrogation_Position=1923; Antisense; TACTGACGCCAGACAATTGACATTA

Paste this into a BLAST search page for me
GTTCGATATTCGCTATGTAATCCTGAAAAGCGTCAAACCCCTGAAGGCATGGAAGTTCTTCCTGCGTTTCGCAAATCACGCTGGATCACTTCGATGACTAATGAACTACCAGACGGAGGCGCAGCAGGCGCAGCTGCATCACGTCAAGTGATAACGATTGGTCGGCTCTGGAGCAATCTGTAGCATGCTGCTCGAGGTGCGAGGTGCTTCAGTGCGCCAGTCAAGAATCACGAGCTCTTTACGCAGCCGATGGAGCCCCAGTTGCTGGAAATCAAAACTGGACTCCGGACTGCAAACGCGAAACGACGATAGCTTCCGGGTACTGTACTGACGCCAGACAATTGACATTA

Full Affymetrix probeset data:

Annotations for 1635079_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720