FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635083_at:

>probe:Drosophila_2:1635083_at:668:211; Interrogation_Position=1557; Antisense; AAGACTAGGTTCTCTAGCCGACATC
>probe:Drosophila_2:1635083_at:713:151; Interrogation_Position=1577; Antisense; ACATCGATGATTTTCCGTCCCAGGG
>probe:Drosophila_2:1635083_at:568:263; Interrogation_Position=1597; Antisense; CAGGGCCCCTTGAACGCATTAGTAG
>probe:Drosophila_2:1635083_at:449:345; Interrogation_Position=1612; Antisense; GCATTAGTAGGTAATCCCGCCGATT
>probe:Drosophila_2:1635083_at:544:719; Interrogation_Position=1635; Antisense; TTGCCTAGTGGCGAGACGTCCTATA
>probe:Drosophila_2:1635083_at:346:421; Interrogation_Position=1647; Antisense; GAGACGTCCTATACGATTGCCGTTG
>probe:Drosophila_2:1635083_at:637:7; Interrogation_Position=1662; Antisense; ATTGCCGTTGCGTAAACATCACACC
>probe:Drosophila_2:1635083_at:208:719; Interrogation_Position=1687; Antisense; TTCCATTTCCAAAGCACTCAGACAG
>probe:Drosophila_2:1635083_at:88:83; Interrogation_Position=1735; Antisense; AGGGAGCGACTGCAACTTCAGCTAC
>probe:Drosophila_2:1635083_at:546:163; Interrogation_Position=1786; Antisense; AAATTTCCACTGGTGTTTGATGCAC
>probe:Drosophila_2:1635083_at:405:53; Interrogation_Position=1829; Antisense; ATGCATTCAAGCCAATTTCACCCAT
>probe:Drosophila_2:1635083_at:705:695; Interrogation_Position=1909; Antisense; TTTCCGAAACATGGTTCTGTACGCC
>probe:Drosophila_2:1635083_at:484:663; Interrogation_Position=2009; Antisense; TAAATCCCACCTCGGACAATCTTAA
>probe:Drosophila_2:1635083_at:448:631; Interrogation_Position=2053; Antisense; TCCTGTTCATCGACGGCTGTTGAAA

Paste this into a BLAST search page for me
AAGACTAGGTTCTCTAGCCGACATCACATCGATGATTTTCCGTCCCAGGGCAGGGCCCCTTGAACGCATTAGTAGGCATTAGTAGGTAATCCCGCCGATTTTGCCTAGTGGCGAGACGTCCTATAGAGACGTCCTATACGATTGCCGTTGATTGCCGTTGCGTAAACATCACACCTTCCATTTCCAAAGCACTCAGACAGAGGGAGCGACTGCAACTTCAGCTACAAATTTCCACTGGTGTTTGATGCACATGCATTCAAGCCAATTTCACCCATTTTCCGAAACATGGTTCTGTACGCCTAAATCCCACCTCGGACAATCTTAATCCTGTTCATCGACGGCTGTTGAAA

Full Affymetrix probeset data:

Annotations for 1635083_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720