Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635084_at:

>probe:Drosophila_2:1635084_at:571:327; Interrogation_Position=1119; Antisense; GCGGGAAAAGCTGGCAAACCTCTAT
>probe:Drosophila_2:1635084_at:661:175; Interrogation_Position=1134; Antisense; AAACCTCTATTATTCCCTGCACGTG
>probe:Drosophila_2:1635084_at:702:109; Interrogation_Position=1163; Antisense; AGCAACTTTCCGGAGTGGGATTCAA
>probe:Drosophila_2:1635084_at:335:23; Interrogation_Position=1236; Antisense; ATATGTTGGTTGTATTGCCTCTCGT
>probe:Drosophila_2:1635084_at:243:715; Interrogation_Position=1263; Antisense; TTCGTTGCGCGGCTTTAATTGCTCC
>probe:Drosophila_2:1635084_at:249:645; Interrogation_Position=1278; Antisense; TAATTGCTCCCTTTGGGTTCTATTC
>probe:Drosophila_2:1635084_at:205:529; Interrogation_Position=1292; Antisense; GGGTTCTATTCCATTATCTTAGTGT
>probe:Drosophila_2:1635084_at:499:207; Interrogation_Position=1327; Antisense; AAGCTTAAGCCCAAATCCGTGTTGT
>probe:Drosophila_2:1635084_at:252:207; Interrogation_Position=1423; Antisense; AAGCTCCGACCAATTGCAAATGTGA
>probe:Drosophila_2:1635084_at:721:15; Interrogation_Position=1465; Antisense; ATTTTGTGGCTCTGGGAAGCGCATA
>probe:Drosophila_2:1635084_at:667:253; Interrogation_Position=1497; Antisense; CAACAAACAGTTGGCCGGCGATTCT
>probe:Drosophila_2:1635084_at:459:317; Interrogation_Position=1510; Antisense; GCCGGCGATTCTACAGAGGATCCGA
>probe:Drosophila_2:1635084_at:228:667; Interrogation_Position=1537; Antisense; TTCCCAAAGATTCAGTTTCCAAGCG
>probe:Drosophila_2:1635084_at:97:303; Interrogation_Position=1595; Antisense; CCGAATGGCGCACCGAAGAAGTATT

Paste this into a BLAST search page for me
GCGGGAAAAGCTGGCAAACCTCTATAAACCTCTATTATTCCCTGCACGTGAGCAACTTTCCGGAGTGGGATTCAAATATGTTGGTTGTATTGCCTCTCGTTTCGTTGCGCGGCTTTAATTGCTCCTAATTGCTCCCTTTGGGTTCTATTCGGGTTCTATTCCATTATCTTAGTGTAAGCTTAAGCCCAAATCCGTGTTGTAAGCTCCGACCAATTGCAAATGTGAATTTTGTGGCTCTGGGAAGCGCATACAACAAACAGTTGGCCGGCGATTCTGCCGGCGATTCTACAGAGGATCCGATTCCCAAAGATTCAGTTTCCAAGCGCCGAATGGCGCACCGAAGAAGTATT

Full Affymetrix probeset data:

Annotations for 1635084_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime