Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635086_at:

>probe:Drosophila_2:1635086_at:343:253; Interrogation_Position=539; Antisense; CAAGCTGATCTGGTGGGACGACAAG
>probe:Drosophila_2:1635086_at:467:397; Interrogation_Position=558; Antisense; GACAAGGCCATTTACCTGGAGCAGC
>probe:Drosophila_2:1635086_at:301:553; Interrogation_Position=575; Antisense; GGAGCAGCAGTTTATTACCCTTTCG
>probe:Drosophila_2:1635086_at:536:695; Interrogation_Position=595; Antisense; TTTCGGACGGATTTGTACGCGCGGT
>probe:Drosophila_2:1635086_at:49:331; Interrogation_Position=615; Antisense; GCGGTGGCCATGTCCAAGCAGAACA
>probe:Drosophila_2:1635086_at:579:383; Interrogation_Position=635; Antisense; GAACATCACCAACTGCAATGTGCTG
>probe:Drosophila_2:1635086_at:389:487; Interrogation_Position=663; Antisense; GTACTGAAGACCTATCCGGAAACTG
>probe:Drosophila_2:1635086_at:79:561; Interrogation_Position=680; Antisense; GGAAACTGCCCAGCGACCGGAGAAG
>probe:Drosophila_2:1635086_at:566:417; Interrogation_Position=711; Antisense; GAGCTCAAGCTCTGGCTGGATGCCA
>probe:Drosophila_2:1635086_at:704:417; Interrogation_Position=738; Antisense; GAGCTGTCCAGCCAGAAGCTGCGAA
>probe:Drosophila_2:1635086_at:189:43; Interrogation_Position=774; Antisense; ATCGATTGATTGATTCCATCTCCCG
>probe:Drosophila_2:1635086_at:705:479; Interrogation_Position=820; Antisense; GTTTGCCTCATTTACTTAGATTCGT
>probe:Drosophila_2:1635086_at:287:675; Interrogation_Position=890; Antisense; TAGACTGGTGGGTTTTTCACACAAA
>probe:Drosophila_2:1635086_at:249:341; Interrogation_Position=986; Antisense; GCTATTATTTTTTCACTGTGCCTTA

Paste this into a BLAST search page for me
CAAGCTGATCTGGTGGGACGACAAGGACAAGGCCATTTACCTGGAGCAGCGGAGCAGCAGTTTATTACCCTTTCGTTTCGGACGGATTTGTACGCGCGGTGCGGTGGCCATGTCCAAGCAGAACAGAACATCACCAACTGCAATGTGCTGGTACTGAAGACCTATCCGGAAACTGGGAAACTGCCCAGCGACCGGAGAAGGAGCTCAAGCTCTGGCTGGATGCCAGAGCTGTCCAGCCAGAAGCTGCGAAATCGATTGATTGATTCCATCTCCCGGTTTGCCTCATTTACTTAGATTCGTTAGACTGGTGGGTTTTTCACACAAAGCTATTATTTTTTCACTGTGCCTTA

Full Affymetrix probeset data:

Annotations for 1635086_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime