FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635088_at:

>probe:Drosophila_2:1635088_at:381:225; Interrogation_Position=1165; Antisense; AAGGAGCACGGCATCCTCATCCAGA
>probe:Drosophila_2:1635088_at:705:125; Interrogation_Position=1196; Antisense; AGCCGGGCTTTGTGGCCACAAATAT
>probe:Drosophila_2:1635088_at:128:449; Interrogation_Position=1227; Antisense; GATCCGAAAGGCTAGCGTGTTTGCT
>probe:Drosophila_2:1635088_at:175:601; Interrogation_Position=1244; Antisense; TGTTTGCTCCCTCGCCGGAAACGTA
>probe:Drosophila_2:1635088_at:123:289; Interrogation_Position=1259; Antisense; CGGAAACGTATGTCCGCTCGGCGCT
>probe:Drosophila_2:1635088_at:99:105; Interrogation_Position=1307; Antisense; AGACGGCGGGCTATCTGCCGCATGC
>probe:Drosophila_2:1635088_at:409:53; Interrogation_Position=1328; Antisense; ATGCTCTACTCCAGCTGGTCATCCA
>probe:Drosophila_2:1635088_at:387:383; Interrogation_Position=1375; Antisense; GAACAGTTCGCACGCAACATCGTTA
>probe:Drosophila_2:1635088_at:477:185; Interrogation_Position=1405; Antisense; AACATCCTGGGCACCCGGAAACGTG
>probe:Drosophila_2:1635088_at:32:235; Interrogation_Position=1472; Antisense; AATACGGCGGAGGAGGCATTTAATG
>probe:Drosophila_2:1635088_at:622:233; Interrogation_Position=1541; Antisense; AATCCGGCTAGTCAAATAGCTTACG
>probe:Drosophila_2:1635088_at:21:27; Interrogation_Position=1556; Antisense; ATAGCTTACGTAATTACCGCGTGTC
>probe:Drosophila_2:1635088_at:522:131; Interrogation_Position=1571; Antisense; ACCGCGTGTCATACGAATCCACAAA
>probe:Drosophila_2:1635088_at:248:375; Interrogation_Position=1677; Antisense; GAAGATTCGCAAACAGCCATGTCAT

Paste this into a BLAST search page for me
AAGGAGCACGGCATCCTCATCCAGAAGCCGGGCTTTGTGGCCACAAATATGATCCGAAAGGCTAGCGTGTTTGCTTGTTTGCTCCCTCGCCGGAAACGTACGGAAACGTATGTCCGCTCGGCGCTAGACGGCGGGCTATCTGCCGCATGCATGCTCTACTCCAGCTGGTCATCCAGAACAGTTCGCACGCAACATCGTTAAACATCCTGGGCACCCGGAAACGTGAATACGGCGGAGGAGGCATTTAATGAATCCGGCTAGTCAAATAGCTTACGATAGCTTACGTAATTACCGCGTGTCACCGCGTGTCATACGAATCCACAAAGAAGATTCGCAAACAGCCATGTCAT

Full Affymetrix probeset data:

Annotations for 1635088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720