FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635089_at:

>probe:Drosophila_2:1635089_at:158:67; Interrogation_Position=1464; Antisense; ATGGCAGTTGGATCAAGCCACCGCC
>probe:Drosophila_2:1635089_at:464:307; Interrogation_Position=1496; Antisense; CCACCTATACTCTCCAATTCGAATA
>probe:Drosophila_2:1635089_at:299:635; Interrogation_Position=1514; Antisense; TCGAATATGCACTGTCTAGGAGACT
>probe:Drosophila_2:1635089_at:202:75; Interrogation_Position=1531; Antisense; AGGAGACTTTATCTGCATGAGTGCA
>probe:Drosophila_2:1635089_at:265:387; Interrogation_Position=1557; Antisense; GAAAAGGTCCAGGATCGGTCTACAG
>probe:Drosophila_2:1635089_at:691:125; Interrogation_Position=1580; Antisense; AGCCTGTCGGAGTTCGTGCAAAACT
>probe:Drosophila_2:1635089_at:485:179; Interrogation_Position=1600; Antisense; AAACTTCTACAAATCGCCACATGTG
>probe:Drosophila_2:1635089_at:407:369; Interrogation_Position=1666; Antisense; GAATGCCGAATCGTGCATCCGAAGC
>probe:Drosophila_2:1635089_at:669:187; Interrogation_Position=1695; Antisense; AACAGCCCACAGATGCAGAACGCAT
>probe:Drosophila_2:1635089_at:43:55; Interrogation_Position=1707; Antisense; ATGCAGAACGCATCCAGCAACTCAA
>probe:Drosophila_2:1635089_at:360:41; Interrogation_Position=1766; Antisense; ATCGTTTTGTCGTTGTCGTTACCAG
>probe:Drosophila_2:1635089_at:86:501; Interrogation_Position=1780; Antisense; GTCGTTACCAGACAGTTAATTACCA
>probe:Drosophila_2:1635089_at:471:539; Interrogation_Position=1906; Antisense; GGTTAAAACGCTGGCGCCACGCAGC
>probe:Drosophila_2:1635089_at:594:263; Interrogation_Position=1927; Antisense; CAGCTCTTGGCGTTCATATGCATTA

Paste this into a BLAST search page for me
ATGGCAGTTGGATCAAGCCACCGCCCCACCTATACTCTCCAATTCGAATATCGAATATGCACTGTCTAGGAGACTAGGAGACTTTATCTGCATGAGTGCAGAAAAGGTCCAGGATCGGTCTACAGAGCCTGTCGGAGTTCGTGCAAAACTAAACTTCTACAAATCGCCACATGTGGAATGCCGAATCGTGCATCCGAAGCAACAGCCCACAGATGCAGAACGCATATGCAGAACGCATCCAGCAACTCAAATCGTTTTGTCGTTGTCGTTACCAGGTCGTTACCAGACAGTTAATTACCAGGTTAAAACGCTGGCGCCACGCAGCCAGCTCTTGGCGTTCATATGCATTA

Full Affymetrix probeset data:

Annotations for 1635089_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720