Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635092_at:

>probe:Drosophila_2:1635092_at:495:319; Interrogation_Position=115; Antisense; GCCGACTCGGAGGACTCCCAGATTG
>probe:Drosophila_2:1635092_at:152:75; Interrogation_Position=125; Antisense; AGGACTCCCAGATTGGCCAGGAGGC
>probe:Drosophila_2:1635092_at:326:67; Interrogation_Position=13; Antisense; ATGGCGGTCTCATCGTCCTCGTCGT
>probe:Drosophila_2:1635092_at:452:307; Interrogation_Position=141; Antisense; CCAGGAGGCCAATCCAGGTGGCCAG
>probe:Drosophila_2:1635092_at:594:579; Interrogation_Position=159; Antisense; TGGCCAGGAGAATCAGGGAAATCAC
>probe:Drosophila_2:1635092_at:57:561; Interrogation_Position=175; Antisense; GGAAATCACAGGAGGCGACCGCCGC
>probe:Drosophila_2:1635092_at:7:321; Interrogation_Position=195; Antisense; GCCGCGCCAGAAGATCAATGCTAGA
>probe:Drosophila_2:1635092_at:208:251; Interrogation_Position=210; Antisense; CAATGCTAGAGAGCGCTATCGGACA
>probe:Drosophila_2:1635092_at:111:103; Interrogation_Position=219; Antisense; AGAGCGCTATCGGACATTTAAGTGA
>probe:Drosophila_2:1635092_at:59:633; Interrogation_Position=31; Antisense; TCGTCGTCGTTTTCCAACTACTTGA
>probe:Drosophila_2:1635092_at:712:475; Interrogation_Position=39; Antisense; GTTTTCCAACTACTTGATGGCGGTA
>probe:Drosophila_2:1635092_at:595:149; Interrogation_Position=50; Antisense; ACTTGATGGCGGTATTTGCCCAGGA
>probe:Drosophila_2:1635092_at:419:329; Interrogation_Position=58; Antisense; GCGGTATTTGCCCAGGATAGCAATA
>probe:Drosophila_2:1635092_at:647:675; Interrogation_Position=75; Antisense; TAGCAATAGTAGTGGCAGTGCCAGC

Paste this into a BLAST search page for me
GCCGACTCGGAGGACTCCCAGATTGAGGACTCCCAGATTGGCCAGGAGGCATGGCGGTCTCATCGTCCTCGTCGTCCAGGAGGCCAATCCAGGTGGCCAGTGGCCAGGAGAATCAGGGAAATCACGGAAATCACAGGAGGCGACCGCCGCGCCGCGCCAGAAGATCAATGCTAGACAATGCTAGAGAGCGCTATCGGACAAGAGCGCTATCGGACATTTAAGTGATCGTCGTCGTTTTCCAACTACTTGAGTTTTCCAACTACTTGATGGCGGTAACTTGATGGCGGTATTTGCCCAGGAGCGGTATTTGCCCAGGATAGCAATATAGCAATAGTAGTGGCAGTGCCAGC

Full Affymetrix probeset data:

Annotations for 1635092_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime