FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635096_at:

>probe:Drosophila_2:1635096_at:128:529; Interrogation_Position=1812; Antisense; GGGATCCCCAAGTGTCCAATACAGA
>probe:Drosophila_2:1635096_at:173:667; Interrogation_Position=1848; Antisense; TACAGTCAGTCATACACGATCAGGA
>probe:Drosophila_2:1635096_at:343:307; Interrogation_Position=1901; Antisense; CCAAATTCAACTCGATCACTTTCAC
>probe:Drosophila_2:1635096_at:561:133; Interrogation_Position=1973; Antisense; ACCCGCATCTACATTGCAGATTTCG
>probe:Drosophila_2:1635096_at:663:349; Interrogation_Position=1988; Antisense; GCAGATTTCGTACTAACCTGGTATC
>probe:Drosophila_2:1635096_at:208:661; Interrogation_Position=2001; Antisense; TAACCTGGTATCAGCACGCCTGCGA
>probe:Drosophila_2:1635096_at:149:213; Interrogation_Position=2054; Antisense; AAGAGTCTCAGTCGCCATCGACGGT
>probe:Drosophila_2:1635096_at:323:43; Interrogation_Position=2070; Antisense; ATCGACGGTTCGAGTGCCGCTTCAC
>probe:Drosophila_2:1635096_at:20:87; Interrogation_Position=2115; Antisense; AGTGCCCCAGCTGCAATTATGCGGC
>probe:Drosophila_2:1635096_at:139:553; Interrogation_Position=2145; Antisense; GGAGCGACAACCTAACCAAGCACAT
>probe:Drosophila_2:1635096_at:568:111; Interrogation_Position=2163; Antisense; AGCACATCAAGACCCATTTTGCCAA
>probe:Drosophila_2:1635096_at:29:613; Interrogation_Position=2190; Antisense; TGAAAAAGGACTTCCTGCCGCTGGC
>probe:Drosophila_2:1635096_at:390:649; Interrogation_Position=2218; Antisense; TCAGATGCAGGCCTCCACGGGAATA
>probe:Drosophila_2:1635096_at:728:261; Interrogation_Position=2245; Antisense; CACCAAATGGGAGGCCACCGCATAG

Paste this into a BLAST search page for me
GGGATCCCCAAGTGTCCAATACAGATACAGTCAGTCATACACGATCAGGACCAAATTCAACTCGATCACTTTCACACCCGCATCTACATTGCAGATTTCGGCAGATTTCGTACTAACCTGGTATCTAACCTGGTATCAGCACGCCTGCGAAAGAGTCTCAGTCGCCATCGACGGTATCGACGGTTCGAGTGCCGCTTCACAGTGCCCCAGCTGCAATTATGCGGCGGAGCGACAACCTAACCAAGCACATAGCACATCAAGACCCATTTTGCCAATGAAAAAGGACTTCCTGCCGCTGGCTCAGATGCAGGCCTCCACGGGAATACACCAAATGGGAGGCCACCGCATAG

Full Affymetrix probeset data:

Annotations for 1635096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720