Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635098_a_at:

>probe:Drosophila_2:1635098_a_at:598:433; Interrogation_Position=156; Antisense; GAGTGTCCCTACTTCGTGGAGCTGT
>probe:Drosophila_2:1635098_a_at:15:615; Interrogation_Position=199; Antisense; TGAACCACAAGAACACGCGCAGCGT
>probe:Drosophila_2:1635098_a_at:617:351; Interrogation_Position=217; Antisense; GCAGCGTCTTCTATGCGGGCATCGA
>probe:Drosophila_2:1635098_a_at:408:563; Interrogation_Position=243; Antisense; GGAATCATTCTGGTGCACGACCTTA
>probe:Drosophila_2:1635098_a_at:453:297; Interrogation_Position=280; Antisense; CGCAGAGGCAGCTAATCGACTGGCT
>probe:Drosophila_2:1635098_a_at:445:407; Interrogation_Position=297; Antisense; GACTGGCTGTACGAGATCGTCAACA
>probe:Drosophila_2:1635098_a_at:679:385; Interrogation_Position=338; Antisense; GAACAAATCGAACGGAGCCTCCATG
>probe:Drosophila_2:1635098_a_at:238:299; Interrogation_Position=382; Antisense; CGCTGAGCAGCTTCTCAACGGACAA
>probe:Drosophila_2:1635098_a_at:438:619; Interrogation_Position=396; Antisense; TCAACGGACAACCTCGGAACGGACG
>probe:Drosophila_2:1635098_a_at:509:579; Interrogation_Position=420; Antisense; GGCCACATTCTCTTCGACATGGAGG
>probe:Drosophila_2:1635098_a_at:614:357; Interrogation_Position=461; Antisense; GCAAACGCCTATCCTGGTCATGGGC
>probe:Drosophila_2:1635098_a_at:308:543; Interrogation_Position=494; Antisense; GGATCTCTTGGACGAGAAGCGCCAT
>probe:Drosophila_2:1635098_a_at:686:427; Interrogation_Position=639; Antisense; GAGATTTGGCTAAATTGCCGCAACA
>probe:Drosophila_2:1635098_a_at:404:333; Interrogation_Position=678; Antisense; GCTGGTACCACTGATGCCGTGAAAC

Paste this into a BLAST search page for me
GAGTGTCCCTACTTCGTGGAGCTGTTGAACCACAAGAACACGCGCAGCGTGCAGCGTCTTCTATGCGGGCATCGAGGAATCATTCTGGTGCACGACCTTACGCAGAGGCAGCTAATCGACTGGCTGACTGGCTGTACGAGATCGTCAACAGAACAAATCGAACGGAGCCTCCATGCGCTGAGCAGCTTCTCAACGGACAATCAACGGACAACCTCGGAACGGACGGGCCACATTCTCTTCGACATGGAGGGCAAACGCCTATCCTGGTCATGGGCGGATCTCTTGGACGAGAAGCGCCATGAGATTTGGCTAAATTGCCGCAACAGCTGGTACCACTGATGCCGTGAAAC

Full Affymetrix probeset data:

Annotations for 1635098_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime