FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635099_at:

>probe:Drosophila_2:1635099_at:288:183; Interrogation_Position=1778; Antisense; AAAACCACAAGCCTCGAATCGAACT
>probe:Drosophila_2:1635099_at:669:363; Interrogation_Position=1793; Antisense; GAATCGAACTCGAGTCGACGTTCTT
>probe:Drosophila_2:1635099_at:676:501; Interrogation_Position=1806; Antisense; GTCGACGTTCTTGATCCGAGTAAAC
>probe:Drosophila_2:1635099_at:190:23; Interrogation_Position=1831; Antisense; ATATACACATATTTGCCGCCTGTGC
>probe:Drosophila_2:1635099_at:474:523; Interrogation_Position=1874; Antisense; GGGCTGACATATCACGACTCCAATG
>probe:Drosophila_2:1635099_at:145:357; Interrogation_Position=1907; Antisense; GCACAGTGGGTCTTCGGGTCTCATG
>probe:Drosophila_2:1635099_at:107:645; Interrogation_Position=1927; Antisense; TCATGCCGCTTGCTTTACTTTTAAT
>probe:Drosophila_2:1635099_at:198:609; Interrogation_Position=1984; Antisense; TGAGAATTTTCTTAGCGAGCGCATT
>probe:Drosophila_2:1635099_at:295:123; Interrogation_Position=1997; Antisense; AGCGAGCGCATTTCTTAAACAGTTG
>probe:Drosophila_2:1635099_at:95:469; Interrogation_Position=2018; Antisense; GTTGCTACTGGCTTTAAGCAGCCGA
>probe:Drosophila_2:1635099_at:281:643; Interrogation_Position=2046; Antisense; TCTTATGCTTTTGATCTTGTTTCCA
>probe:Drosophila_2:1635099_at:76:579; Interrogation_Position=2145; Antisense; TACGAAGTGTACTGGTTTGCTAACC
>probe:Drosophila_2:1635099_at:504:479; Interrogation_Position=2159; Antisense; GTTTGCTAACCAGCAATGTCTCGCT
>probe:Drosophila_2:1635099_at:64:231; Interrogation_Position=2173; Antisense; AATGTCTCGCTGTTGCTAAATGGAT

Paste this into a BLAST search page for me
AAAACCACAAGCCTCGAATCGAACTGAATCGAACTCGAGTCGACGTTCTTGTCGACGTTCTTGATCCGAGTAAACATATACACATATTTGCCGCCTGTGCGGGCTGACATATCACGACTCCAATGGCACAGTGGGTCTTCGGGTCTCATGTCATGCCGCTTGCTTTACTTTTAATTGAGAATTTTCTTAGCGAGCGCATTAGCGAGCGCATTTCTTAAACAGTTGGTTGCTACTGGCTTTAAGCAGCCGATCTTATGCTTTTGATCTTGTTTCCATACGAAGTGTACTGGTTTGCTAACCGTTTGCTAACCAGCAATGTCTCGCTAATGTCTCGCTGTTGCTAAATGGAT

Full Affymetrix probeset data:

Annotations for 1635099_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720