Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635101_at:

>probe:Drosophila_2:1635101_at:692:315; Interrogation_Position=2210; Antisense; GCCTGCGACCCTTTAAGTGTTCGGA
>probe:Drosophila_2:1635101_at:516:397; Interrogation_Position=2245; Antisense; GACAAGACCTTCAGCCGCAAAGAGC
>probe:Drosophila_2:1635101_at:211:567; Interrogation_Position=2279; Antisense; GGCACTTAGTATCCCATTCTGGACA
>probe:Drosophila_2:1635101_at:225:623; Interrogation_Position=2317; Antisense; TGCGAGGTGTGCAAAAAGCCCTTCT
>probe:Drosophila_2:1635101_at:680:133; Interrogation_Position=2380; Antisense; ACGCAGACATCAACCGAAACCTTAT
>probe:Drosophila_2:1635101_at:342:693; Interrogation_Position=2431; Antisense; TTTGCCACCAAGTTGCACTACGAGA
>probe:Drosophila_2:1635101_at:651:281; Interrogation_Position=2531; Antisense; CTGCGCTAACTCACGTTCGAAGCAA
>probe:Drosophila_2:1635101_at:684:495; Interrogation_Position=2558; Antisense; GTCAGGTGCCCAATAAGGCGGTTTT
>probe:Drosophila_2:1635101_at:542:179; Interrogation_Position=2590; Antisense; AAACAAGAACGTTCTGCTCAGCAGA
>probe:Drosophila_2:1635101_at:500:131; Interrogation_Position=2631; Antisense; ACCGGCCCAGGTAATGCATGTTGTG
>probe:Drosophila_2:1635101_at:617:347; Interrogation_Position=2646; Antisense; GCATGTTGTGACTACCCAGGATCTG
>probe:Drosophila_2:1635101_at:173:25; Interrogation_Position=2711; Antisense; ATATGCCCGGATCTCTGGCCAATTA
>probe:Drosophila_2:1635101_at:652:579; Interrogation_Position=2726; Antisense; TGGCCAATTACGTCCAGCTGGGCTT
>probe:Drosophila_2:1635101_at:582:119; Interrogation_Position=2741; Antisense; AGCTGGGCTTTTCTCAGTTCCAGAA

Paste this into a BLAST search page for me
GCCTGCGACCCTTTAAGTGTTCGGAGACAAGACCTTCAGCCGCAAAGAGCGGCACTTAGTATCCCATTCTGGACATGCGAGGTGTGCAAAAAGCCCTTCTACGCAGACATCAACCGAAACCTTATTTTGCCACCAAGTTGCACTACGAGACTGCGCTAACTCACGTTCGAAGCAAGTCAGGTGCCCAATAAGGCGGTTTTAAACAAGAACGTTCTGCTCAGCAGAACCGGCCCAGGTAATGCATGTTGTGGCATGTTGTGACTACCCAGGATCTGATATGCCCGGATCTCTGGCCAATTATGGCCAATTACGTCCAGCTGGGCTTAGCTGGGCTTTTCTCAGTTCCAGAA

Full Affymetrix probeset data:

Annotations for 1635101_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime