FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635102_at:

>probe:Drosophila_2:1635102_at:187:581; Interrogation_Position=146; Antisense; TGGCCGAGCGGCCAAAATCGATGCC
>probe:Drosophila_2:1635102_at:105:497; Interrogation_Position=15; Antisense; GTCATTAAGATGGACTTGTCAGCCC
>probe:Drosophila_2:1635102_at:585:163; Interrogation_Position=160; Antisense; AAATCGATGCCCCAACCGGTTCGCT
>probe:Drosophila_2:1635102_at:626:1; Interrogation_Position=172; Antisense; CAACCGGTTCGCTCTCGCGTTTTGG
>probe:Drosophila_2:1635102_at:5:329; Interrogation_Position=188; Antisense; GCGTTTTGGCGAGTGGCCCAAGCTT
>probe:Drosophila_2:1635102_at:201:581; Interrogation_Position=194; Antisense; TGGCGAGTGGCCCAAGCTTTTCAGC
>probe:Drosophila_2:1635102_at:572:433; Interrogation_Position=198; Antisense; GAGTGGCCCAAGCTTTTCAGCGCTG
>probe:Drosophila_2:1635102_at:387:207; Interrogation_Position=207; Antisense; AAGCTTTTCAGCGCTGCTCCTGGAG
>probe:Drosophila_2:1635102_at:190:441; Interrogation_Position=23; Antisense; GATGGACTTGTCAGCCCAAAAACGT
>probe:Drosophila_2:1635102_at:418:401; Interrogation_Position=27; Antisense; GACTTGTCAGCCCAAAAACGTAGGG
>probe:Drosophila_2:1635102_at:3:651; Interrogation_Position=54; Antisense; TCAGCCATGTCCAGCTGGCCTAAAG
>probe:Drosophila_2:1635102_at:694:597; Interrogation_Position=61; Antisense; TGTCCAGCTGGCCTAAAGTCTTCCC
>probe:Drosophila_2:1635102_at:728:305; Interrogation_Position=71; Antisense; GCCTAAAGTCTTCCCCTCCGAGATT
>probe:Drosophila_2:1635102_at:523:295; Interrogation_Position=89; Antisense; CGAGATTTCCGCTGCCCAAAAGCTC

Paste this into a BLAST search page for me
TGGCCGAGCGGCCAAAATCGATGCCGTCATTAAGATGGACTTGTCAGCCCAAATCGATGCCCCAACCGGTTCGCTCAACCGGTTCGCTCTCGCGTTTTGGGCGTTTTGGCGAGTGGCCCAAGCTTTGGCGAGTGGCCCAAGCTTTTCAGCGAGTGGCCCAAGCTTTTCAGCGCTGAAGCTTTTCAGCGCTGCTCCTGGAGGATGGACTTGTCAGCCCAAAAACGTGACTTGTCAGCCCAAAAACGTAGGGTCAGCCATGTCCAGCTGGCCTAAAGTGTCCAGCTGGCCTAAAGTCTTCCCGCCTAAAGTCTTCCCCTCCGAGATTCGAGATTTCCGCTGCCCAAAAGCTC

Full Affymetrix probeset data:

Annotations for 1635102_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720