FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635103_at:

>probe:Drosophila_2:1635103_at:530:217; Interrogation_Position=7499; Antisense; AAGTTTTGTATATGTGCCCACTGTA
>probe:Drosophila_2:1635103_at:671:257; Interrogation_Position=7517; Antisense; CACTGTAGCCAATTCGTATCCTTTA
>probe:Drosophila_2:1635103_at:424:483; Interrogation_Position=7532; Antisense; GTATCCTTTATATCGCTCTTAAGTG
>probe:Drosophila_2:1635103_at:5:61; Interrogation_Position=7626; Antisense; ATGTTACTGCTAGGACACGACCACC
>probe:Drosophila_2:1635103_at:637:413; Interrogation_Position=7644; Antisense; GACCACCCCTGTAATGTATTTCGGA
>probe:Drosophila_2:1635103_at:493:87; Interrogation_Position=7685; Antisense; AGTCGCTGGAGCACCTAATTTTATT
>probe:Drosophila_2:1635103_at:385:693; Interrogation_Position=7708; Antisense; TTTGTTTTAGCACCATCTCCACATT
>probe:Drosophila_2:1635103_at:264:273; Interrogation_Position=7738; Antisense; CTACCACCATTGCAATTATCGCGAG
>probe:Drosophila_2:1635103_at:645:149; Interrogation_Position=7793; Antisense; ACTTGACTTTATGCGTGTGTGCCTT
>probe:Drosophila_2:1635103_at:347:275; Interrogation_Position=7815; Antisense; CTTCCCCTCTGTTTACCATTATTAT
>probe:Drosophila_2:1635103_at:606:37; Interrogation_Position=7862; Antisense; ATCTTTCAATATTCGGCCACTTTAC
>probe:Drosophila_2:1635103_at:202:685; Interrogation_Position=7916; Antisense; TATCGTGCGCAACCTTCTTTGAATA
>probe:Drosophila_2:1635103_at:728:385; Interrogation_Position=8028; Antisense; GAACAACGTGTATTTTTCATCCCCT
>probe:Drosophila_2:1635103_at:29:163; Interrogation_Position=8069; Antisense; AAATTTTATGCCACCATTTTACGCA

Paste this into a BLAST search page for me
AAGTTTTGTATATGTGCCCACTGTACACTGTAGCCAATTCGTATCCTTTAGTATCCTTTATATCGCTCTTAAGTGATGTTACTGCTAGGACACGACCACCGACCACCCCTGTAATGTATTTCGGAAGTCGCTGGAGCACCTAATTTTATTTTTGTTTTAGCACCATCTCCACATTCTACCACCATTGCAATTATCGCGAGACTTGACTTTATGCGTGTGTGCCTTCTTCCCCTCTGTTTACCATTATTATATCTTTCAATATTCGGCCACTTTACTATCGTGCGCAACCTTCTTTGAATAGAACAACGTGTATTTTTCATCCCCTAAATTTTATGCCACCATTTTACGCA

Full Affymetrix probeset data:

Annotations for 1635103_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720