FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635106_at:

>probe:Drosophila_2:1635106_at:137:205; Interrogation_Position=209; Antisense; AAGCCCATACGTATGTATCTTTGCA
>probe:Drosophila_2:1635106_at:667:37; Interrogation_Position=225; Antisense; ATCTTTGCATCTTTCGGTTCGGTAA
>probe:Drosophila_2:1635106_at:449:221; Interrogation_Position=277; Antisense; AAGTGTTATCATCAGCTGGAGAGCT
>probe:Drosophila_2:1635106_at:540:219; Interrogation_Position=347; Antisense; AAGTCCATCATGCAGGAAGCCACAA
>probe:Drosophila_2:1635106_at:400:441; Interrogation_Position=406; Antisense; GATGTCCGAGCCACGGAGAGGCTTC
>probe:Drosophila_2:1635106_at:194:425; Interrogation_Position=421; Antisense; GAGAGGCTTCAGCTTGGACTCACTG
>probe:Drosophila_2:1635106_at:558:565; Interrogation_Position=453; Antisense; GGCACGTGGAAAGCGATCCCCAGCA
>probe:Drosophila_2:1635106_at:19:147; Interrogation_Position=510; Antisense; ACTACAGCCCAGGTGATCAGGTCAA
>probe:Drosophila_2:1635106_at:283:115; Interrogation_Position=567; Antisense; AGCAGGATCACCATGGTCACCATCT
>probe:Drosophila_2:1635106_at:492:469; Interrogation_Position=617; Antisense; GTTGCCGCCGAGATTCAGCTAAACG
>probe:Drosophila_2:1635106_at:209:309; Interrogation_Position=668; Antisense; GCCAACCAAAATAGTCCTTATCCCA
>probe:Drosophila_2:1635106_at:579:273; Interrogation_Position=684; Antisense; CTTATCCCATCTATAGCTACTATCG
>probe:Drosophila_2:1635106_at:506:363; Interrogation_Position=727; Antisense; GAATAATGGTTCTCCCGGTGCCGAT
>probe:Drosophila_2:1635106_at:502:289; Interrogation_Position=742; Antisense; CGGTGCCGATCTGCCCTGGAGGTAA

Paste this into a BLAST search page for me
AAGCCCATACGTATGTATCTTTGCAATCTTTGCATCTTTCGGTTCGGTAAAAGTGTTATCATCAGCTGGAGAGCTAAGTCCATCATGCAGGAAGCCACAAGATGTCCGAGCCACGGAGAGGCTTCGAGAGGCTTCAGCTTGGACTCACTGGGCACGTGGAAAGCGATCCCCAGCAACTACAGCCCAGGTGATCAGGTCAAAGCAGGATCACCATGGTCACCATCTGTTGCCGCCGAGATTCAGCTAAACGGCCAACCAAAATAGTCCTTATCCCACTTATCCCATCTATAGCTACTATCGGAATAATGGTTCTCCCGGTGCCGATCGGTGCCGATCTGCCCTGGAGGTAA

Full Affymetrix probeset data:

Annotations for 1635106_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720