Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635108_at:

>probe:Drosophila_2:1635108_at:34:621; Interrogation_Position=2472; Antisense; TGCTCCAGGCCAAGCTTAAGGTCAT
>probe:Drosophila_2:1635108_at:447:251; Interrogation_Position=2500; Antisense; CAAGCGGGCCCAGGAAATCGCGGAA
>probe:Drosophila_2:1635108_at:100:171; Interrogation_Position=2524; Antisense; AAAGGAGGCACAGCTGGCCCACGAA
>probe:Drosophila_2:1635108_at:290:297; Interrogation_Position=2562; Antisense; CGCAGGATCGTATGGCTTTGGTCAA
>probe:Drosophila_2:1635108_at:312:377; Interrogation_Position=2593; Antisense; GAAGCAGATTTCTCGCAGCAGGTGT
>probe:Drosophila_2:1635108_at:25:359; Interrogation_Position=2666; Antisense; GCAAATGTAAATCCCACAGCAGCCA
>probe:Drosophila_2:1635108_at:621:293; Interrogation_Position=2692; Antisense; CGATCTTCAACTGCCTCAAGTGACA
>probe:Drosophila_2:1635108_at:358:221; Interrogation_Position=2709; Antisense; AAGTGACACCCAGTCATGCGGAGCT
>probe:Drosophila_2:1635108_at:549:553; Interrogation_Position=2728; Antisense; GGAGCTGCTGCTTAAAATGTCCCAG
>probe:Drosophila_2:1635108_at:714:123; Interrogation_Position=2809; Antisense; AGCCTCCTACCGCAGGATGTACAAT
>probe:Drosophila_2:1635108_at:420:485; Interrogation_Position=2844; Antisense; GTAGTTCAATCGATGATCCCGACTA
>probe:Drosophila_2:1635108_at:161:411; Interrogation_Position=2858; Antisense; GATCCCGACTATCTATTGACGTTAG
>probe:Drosophila_2:1635108_at:224:287; Interrogation_Position=2883; Antisense; CTGGTGGGCTGGACGACGACTCCAA
>probe:Drosophila_2:1635108_at:505:81; Interrogation_Position=2907; Antisense; AGGTGGCCATGGATCACGGCCTGAA

Paste this into a BLAST search page for me
TGCTCCAGGCCAAGCTTAAGGTCATCAAGCGGGCCCAGGAAATCGCGGAAAAAGGAGGCACAGCTGGCCCACGAACGCAGGATCGTATGGCTTTGGTCAAGAAGCAGATTTCTCGCAGCAGGTGTGCAAATGTAAATCCCACAGCAGCCACGATCTTCAACTGCCTCAAGTGACAAAGTGACACCCAGTCATGCGGAGCTGGAGCTGCTGCTTAAAATGTCCCAGAGCCTCCTACCGCAGGATGTACAATGTAGTTCAATCGATGATCCCGACTAGATCCCGACTATCTATTGACGTTAGCTGGTGGGCTGGACGACGACTCCAAAGGTGGCCATGGATCACGGCCTGAA

Full Affymetrix probeset data:

Annotations for 1635108_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime