FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635109_at:

>probe:Drosophila_2:1635109_at:125:179; Interrogation_Position=1315; Antisense; AAAAATGCCGACTGGGCTCGATCCA
>probe:Drosophila_2:1635109_at:196:525; Interrogation_Position=1328; Antisense; GGGCTCGATCCACGAATGCAACAAT
>probe:Drosophila_2:1635109_at:403:533; Interrogation_Position=1377; Antisense; GGTGTGCATCTACTGCAAGCGAGAT
>probe:Drosophila_2:1635109_at:303:57; Interrogation_Position=1400; Antisense; ATGAGTATCTGGACCACTTTGCCGA
>probe:Drosophila_2:1635109_at:545:317; Interrogation_Position=1420; Antisense; GCCGACTCGGAGAACTGCAATAAGC
>probe:Drosophila_2:1635109_at:177:449; Interrogation_Position=1503; Antisense; GATGCCAACGCACTCCTGGAAAAAG
>probe:Drosophila_2:1635109_at:479:169; Interrogation_Position=1524; Antisense; AAAGGCCAAGGAATATCCCGTTGAG
>probe:Drosophila_2:1635109_at:517:45; Interrogation_Position=1538; Antisense; ATCCCGTTGAGGAAGAGCAGCCCTA
>probe:Drosophila_2:1635109_at:59:1; Interrogation_Position=1557; Antisense; GCCCTAAGCTCCAAACGGTTCGTTG
>probe:Drosophila_2:1635109_at:524:279; Interrogation_Position=1572; Antisense; CGGTTCGTTGGGATTTTACGCATCA
>probe:Drosophila_2:1635109_at:315:543; Interrogation_Position=1613; Antisense; GGATATCTGAGTAGCTTATTTCTGA
>probe:Drosophila_2:1635109_at:195:573; Interrogation_Position=1659; Antisense; GGCTGAAGCTATTTGTTTCCCGAAT
>probe:Drosophila_2:1635109_at:588:239; Interrogation_Position=1695; Antisense; AATACTCCCATATATGTTCACCTGC
>probe:Drosophila_2:1635109_at:555:59; Interrogation_Position=1708; Antisense; ATGTTCACCTGCTAAGTATCTTTTG

Paste this into a BLAST search page for me
AAAAATGCCGACTGGGCTCGATCCAGGGCTCGATCCACGAATGCAACAATGGTGTGCATCTACTGCAAGCGAGATATGAGTATCTGGACCACTTTGCCGAGCCGACTCGGAGAACTGCAATAAGCGATGCCAACGCACTCCTGGAAAAAGAAAGGCCAAGGAATATCCCGTTGAGATCCCGTTGAGGAAGAGCAGCCCTAGCCCTAAGCTCCAAACGGTTCGTTGCGGTTCGTTGGGATTTTACGCATCAGGATATCTGAGTAGCTTATTTCTGAGGCTGAAGCTATTTGTTTCCCGAATAATACTCCCATATATGTTCACCTGCATGTTCACCTGCTAAGTATCTTTTG

Full Affymetrix probeset data:

Annotations for 1635109_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720