FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635110_at:

>probe:Drosophila_2:1635110_at:122:549; Interrogation_Position=1067; Antisense; GGAGATGCCCTACCTGGACCAAGTG
>probe:Drosophila_2:1635110_at:553:553; Interrogation_Position=1082; Antisense; GGACCAAGTGGTTGCCGAGACGCTT
>probe:Drosophila_2:1635110_at:473:423; Interrogation_Position=1098; Antisense; GAGACGCTTCGCAAGTATCCTATAC
>probe:Drosophila_2:1635110_at:345:707; Interrogation_Position=1131; Antisense; TTACTGAGGCGTTCCACCAAGGAGT
>probe:Drosophila_2:1635110_at:172:243; Interrogation_Position=1167; Antisense; AATAGCAACCTAATCCTGGAGCCGG
>probe:Drosophila_2:1635110_at:501:25; Interrogation_Position=1216; Antisense; ATAGTATTCATCACGACCCAGAGCT
>probe:Drosophila_2:1635110_at:483:309; Interrogation_Position=1233; Antisense; CCAGAGCTTTATCCCGATCCAGAAA
>probe:Drosophila_2:1635110_at:294:217; Interrogation_Position=1257; Antisense; AAGTTTGATCCCAGTCGCTTTGAGC
>probe:Drosophila_2:1635110_at:349:7; Interrogation_Position=1290; Antisense; ATTAAGGCTAGGCATCCTTTCGCCT
>probe:Drosophila_2:1635110_at:234:687; Interrogation_Position=1314; Antisense; TATTTGCCTTTTGGCGAGGGTCCTC
>probe:Drosophila_2:1635110_at:493:507; Interrogation_Position=1380; Antisense; GTGGGTCTTGTATACCTTCTAAGGG
>probe:Drosophila_2:1635110_at:698:97; Interrogation_Position=1435; Antisense; AGATCCCGCTGAAGTTTTCCAGTCG
>probe:Drosophila_2:1635110_at:588:87; Interrogation_Position=1455; Antisense; AGTCGTAATTTCCTGATATCCACCC
>probe:Drosophila_2:1635110_at:519:229; Interrogation_Position=1539; Antisense; AATGTGTATAATCCTGACAGCGCGA

Paste this into a BLAST search page for me
GGAGATGCCCTACCTGGACCAAGTGGGACCAAGTGGTTGCCGAGACGCTTGAGACGCTTCGCAAGTATCCTATACTTACTGAGGCGTTCCACCAAGGAGTAATAGCAACCTAATCCTGGAGCCGGATAGTATTCATCACGACCCAGAGCTCCAGAGCTTTATCCCGATCCAGAAAAAGTTTGATCCCAGTCGCTTTGAGCATTAAGGCTAGGCATCCTTTCGCCTTATTTGCCTTTTGGCGAGGGTCCTCGTGGGTCTTGTATACCTTCTAAGGGAGATCCCGCTGAAGTTTTCCAGTCGAGTCGTAATTTCCTGATATCCACCCAATGTGTATAATCCTGACAGCGCGA

Full Affymetrix probeset data:

Annotations for 1635110_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720