Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635111_s_at:

>probe:Drosophila_2:1635111_s_at:504:643; Interrogation_Position=438; Antisense; TCTAGACTACGATCGCTTGCACTTC
>probe:Drosophila_2:1635111_s_at:403:109; Interrogation_Position=494; Antisense; AGAAGCAGCTGGACCTAGCGGCCGA
>probe:Drosophila_2:1635111_s_at:452:393; Interrogation_Position=548; Antisense; GAAATGCTGCCGAGGACTTCATGGG
>probe:Drosophila_2:1635111_s_at:725:591; Interrogation_Position=620; Antisense; TGGTGCACAGCTTTACAGGAACTTT
>probe:Drosophila_2:1635111_s_at:180:641; Interrogation_Position=671; Antisense; TCGGCGGTCTCTACATAGGCTTCAA
>probe:Drosophila_2:1635111_s_at:161:23; Interrogation_Position=685; Antisense; ATAGGCTTCAATGGGTGCTCCCTAA
>probe:Drosophila_2:1635111_s_at:12:109; Interrogation_Position=726; Antisense; AGAAGTGGTGCGCAAGCTACCCAAC
>probe:Drosophila_2:1635111_s_at:165:655; Interrogation_Position=758; Antisense; TAATGCTAGAAACCGACTGCCCGTG
>probe:Drosophila_2:1635111_s_at:158:405; Interrogation_Position=772; Antisense; GACTGCCCGTGGTGTGGTATTCGAC
>probe:Drosophila_2:1635111_s_at:358:241; Interrogation_Position=876; Antisense; AATAGACGGACGCTGTGAGCCTTGC
>probe:Drosophila_2:1635111_s_at:409:511; Interrogation_Position=890; Antisense; GTGAGCCTTGCCAAATCAGCCAAGT
>probe:Drosophila_2:1635111_s_at:364:477; Interrogation_Position=913; Antisense; GTTTTGGAGTCTATTGCCGGAATCA
>probe:Drosophila_2:1635111_s_at:583:155; Interrogation_Position=954; Antisense; ACAGCTGGCTGCGTTATACTACCAA
>probe:Drosophila_2:1635111_s_at:713:149; Interrogation_Position=982; Antisense; ACATTGGACTTGTTCTTCGGCACAG

Paste this into a BLAST search page for me
TCTAGACTACGATCGCTTGCACTTCAGAAGCAGCTGGACCTAGCGGCCGAGAAATGCTGCCGAGGACTTCATGGGTGGTGCACAGCTTTACAGGAACTTTTCGGCGGTCTCTACATAGGCTTCAAATAGGCTTCAATGGGTGCTCCCTAAAGAAGTGGTGCGCAAGCTACCCAACTAATGCTAGAAACCGACTGCCCGTGGACTGCCCGTGGTGTGGTATTCGACAATAGACGGACGCTGTGAGCCTTGCGTGAGCCTTGCCAAATCAGCCAAGTGTTTTGGAGTCTATTGCCGGAATCAACAGCTGGCTGCGTTATACTACCAAACATTGGACTTGTTCTTCGGCACAG

Full Affymetrix probeset data:

Annotations for 1635111_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime