FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635112_at:

>probe:Drosophila_2:1635112_at:46:367; Interrogation_Position=132; Antisense; GAATCCCTATGTCCAGTGGTTTCTG
>probe:Drosophila_2:1635112_at:421:139; Interrogation_Position=163; Antisense; ACGGAAATCCCGCTGAGCATCGTTA
>probe:Drosophila_2:1635112_at:598:587; Interrogation_Position=279; Antisense; TGGAGCGGCTGCACCGATTCAGAAA
>probe:Drosophila_2:1635112_at:516:101; Interrogation_Position=303; Antisense; AGCTAGTACTTTCTTCTACATCCTG
>probe:Drosophila_2:1635112_at:318:397; Interrogation_Position=337; Antisense; GACAAGGATCTTTCCGCGGATGAAC
>probe:Drosophila_2:1635112_at:219:497; Interrogation_Position=409; Antisense; GTCTATAATCGCTTTTTCCTAACCA
>probe:Drosophila_2:1635112_at:391:589; Interrogation_Position=445; Antisense; TGGATCTATGATCCCTTCAAGCGTC
>probe:Drosophila_2:1635112_at:675:461; Interrogation_Position=472; Antisense; GATTCCGCCTTTGGACGATTGGTGC
>probe:Drosophila_2:1635112_at:45:31; Interrogation_Position=521; Antisense; ATAAATTGCTCTTCCGCGATATGGC
>probe:Drosophila_2:1635112_at:425:25; Interrogation_Position=539; Antisense; ATATGGCTGGCTATCCACTGCGCAT
>probe:Drosophila_2:1635112_at:378:347; Interrogation_Position=560; Antisense; GCATCCAGATGTTTAGGTCCGTCTA
>probe:Drosophila_2:1635112_at:725:497; Interrogation_Position=580; Antisense; GTCTACACTCGTCCGGAATTCGATA
>probe:Drosophila_2:1635112_at:310:327; Interrogation_Position=635; Antisense; GCGTGGACTTTCTGGTGGCCCAAAT
>probe:Drosophila_2:1635112_at:120:725; Interrogation_Position=673; Antisense; TTGAATTTCACCATGCTACTGCAGC

Paste this into a BLAST search page for me
GAATCCCTATGTCCAGTGGTTTCTGACGGAAATCCCGCTGAGCATCGTTATGGAGCGGCTGCACCGATTCAGAAAAGCTAGTACTTTCTTCTACATCCTGGACAAGGATCTTTCCGCGGATGAACGTCTATAATCGCTTTTTCCTAACCATGGATCTATGATCCCTTCAAGCGTCGATTCCGCCTTTGGACGATTGGTGCATAAATTGCTCTTCCGCGATATGGCATATGGCTGGCTATCCACTGCGCATGCATCCAGATGTTTAGGTCCGTCTAGTCTACACTCGTCCGGAATTCGATAGCGTGGACTTTCTGGTGGCCCAAATTTGAATTTCACCATGCTACTGCAGC

Full Affymetrix probeset data:

Annotations for 1635112_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720