FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635113_at:

>probe:Drosophila_2:1635113_at:724:71; Interrogation_Position=107; Antisense; AGGACACCTTGGATCCGCTAAGGGA
>probe:Drosophila_2:1635113_at:111:339; Interrogation_Position=123; Antisense; GCTAAGGGAGCTTTGCTATCCGGAT
>probe:Drosophila_2:1635113_at:44:545; Interrogation_Position=144; Antisense; GGATAGCGATGTTTTCCTGCTCTGC
>probe:Drosophila_2:1635113_at:37:231; Interrogation_Position=212; Antisense; AATGGGCACCGAAATTCGCCAAGAC
>probe:Drosophila_2:1635113_at:651:365; Interrogation_Position=234; Antisense; GACCAAGGCCGCACTGATTTTGGTT
>probe:Drosophila_2:1635113_at:706:457; Interrogation_Position=249; Antisense; GATTTTGGTTGGCACCCAGGCCGAT
>probe:Drosophila_2:1635113_at:72:89; Interrogation_Position=283; Antisense; AGTCCCAATGTCCTCAACAAACTGC
>probe:Drosophila_2:1635113_at:297:363; Interrogation_Position=325; Antisense; GCAATTTCATATGCAGACGCCTGGG
>probe:Drosophila_2:1635113_at:461:103; Interrogation_Position=339; Antisense; AGACGCCTGGGATTTGGCAACAACA
>probe:Drosophila_2:1635113_at:278:607; Interrogation_Position=381; Antisense; TGAGACTTCGTCAGCCACACAGGGA
>probe:Drosophila_2:1635113_at:641:525; Interrogation_Position=402; Antisense; GGGAGCATACCCTAATGACTACAAA
>probe:Drosophila_2:1635113_at:692:209; Interrogation_Position=46; Antisense; AAGACCGATGTCAACGTTAACGAGA
>probe:Drosophila_2:1635113_at:175:427; Interrogation_Position=67; Antisense; GAGAGTCCGGTGCATTTGACCATTT
>probe:Drosophila_2:1635113_at:19:611; Interrogation_Position=83; Antisense; TGACCATTTGTGATACCGCTGGCCA

Paste this into a BLAST search page for me
AGGACACCTTGGATCCGCTAAGGGAGCTAAGGGAGCTTTGCTATCCGGATGGATAGCGATGTTTTCCTGCTCTGCAATGGGCACCGAAATTCGCCAAGACGACCAAGGCCGCACTGATTTTGGTTGATTTTGGTTGGCACCCAGGCCGATAGTCCCAATGTCCTCAACAAACTGCGCAATTTCATATGCAGACGCCTGGGAGACGCCTGGGATTTGGCAACAACATGAGACTTCGTCAGCCACACAGGGAGGGAGCATACCCTAATGACTACAAAAAGACCGATGTCAACGTTAACGAGAGAGAGTCCGGTGCATTTGACCATTTTGACCATTTGTGATACCGCTGGCCA

Full Affymetrix probeset data:

Annotations for 1635113_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720