Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635115_at:

>probe:Drosophila_2:1635115_at:599:445; Interrogation_Position=1672; Antisense; GATGCACCCGATAAATCGCCACTAA
>probe:Drosophila_2:1635115_at:375:145; Interrogation_Position=1692; Antisense; ACTAAACTCTTTTGTAGGCACCAAG
>probe:Drosophila_2:1635115_at:427:517; Interrogation_Position=1791; Antisense; GTGTGTTGAAGCCAAACCGTTACTA
>probe:Drosophila_2:1635115_at:162:149; Interrogation_Position=1835; Antisense; ACTTTATGCTGTCTTATGGCCCTAA
>probe:Drosophila_2:1635115_at:82:69; Interrogation_Position=1850; Antisense; ATGGCCCTAATATGGGTTTCTTTCA
>probe:Drosophila_2:1635115_at:684:377; Interrogation_Position=1909; Antisense; GAAGCTTCCACTACGACTAATCAGA
>probe:Drosophila_2:1635115_at:399:373; Interrogation_Position=1936; Antisense; GAAGTGCCCAAGAAGTGCCCCAAAA
>probe:Drosophila_2:1635115_at:625:223; Interrogation_Position=1993; Antisense; AAGGAGCCATCGCAGCACTTTAAAA
>probe:Drosophila_2:1635115_at:275:171; Interrogation_Position=2016; Antisense; AAAGACCTGCTCCTTATGCAAGTGT
>probe:Drosophila_2:1635115_at:259:177; Interrogation_Position=2050; Antisense; AAACGTTCCGAATTGCAGCCTTATA
>probe:Drosophila_2:1635115_at:302:109; Interrogation_Position=2087; Antisense; AGAAGCGGCGTCAACGATTGGAATT
>probe:Drosophila_2:1635115_at:195:257; Interrogation_Position=2168; Antisense; CAAAGGAAGCCTGCACACGCGATGG
>probe:Drosophila_2:1635115_at:656:259; Interrogation_Position=2183; Antisense; CACGCGATGGCCTAGCTATATGTTA
>probe:Drosophila_2:1635115_at:646:423; Interrogation_Position=2209; Antisense; GAGACTCTCAATCTTTGTCAGCAGA

Paste this into a BLAST search page for me
GATGCACCCGATAAATCGCCACTAAACTAAACTCTTTTGTAGGCACCAAGGTGTGTTGAAGCCAAACCGTTACTAACTTTATGCTGTCTTATGGCCCTAAATGGCCCTAATATGGGTTTCTTTCAGAAGCTTCCACTACGACTAATCAGAGAAGTGCCCAAGAAGTGCCCCAAAAAAGGAGCCATCGCAGCACTTTAAAAAAAGACCTGCTCCTTATGCAAGTGTAAACGTTCCGAATTGCAGCCTTATAAGAAGCGGCGTCAACGATTGGAATTCAAAGGAAGCCTGCACACGCGATGGCACGCGATGGCCTAGCTATATGTTAGAGACTCTCAATCTTTGTCAGCAGA

Full Affymetrix probeset data:

Annotations for 1635115_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime