Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1635117_at:

>probe:Drosophila_2:1635117_at:324:293; Interrogation_Position=2704; Antisense; CGAGGCGTACGGATCCTGGAAGCAA
>probe:Drosophila_2:1635117_at:322:101; Interrogation_Position=2743; Antisense; AGAGTGTAGACGATGCAAGCTCCCC
>probe:Drosophila_2:1635117_at:250:497; Interrogation_Position=2771; Antisense; GTCATTACAAACATCTCATCGCTTC
>probe:Drosophila_2:1635117_at:183:191; Interrogation_Position=2780; Antisense; AACATCTCATCGCTTCAACTAAAAC
>probe:Drosophila_2:1635117_at:226:223; Interrogation_Position=2809; Antisense; AAGGTGTAGTCAACCATTCAGCTAA
>probe:Drosophila_2:1635117_at:1:111; Interrogation_Position=2871; Antisense; AGCAAAATGCTTCGTCTATTCCTAG
>probe:Drosophila_2:1635117_at:178:497; Interrogation_Position=2884; Antisense; GTCTATTCCTAGCATAGTTGCACGT
>probe:Drosophila_2:1635117_at:644:467; Interrogation_Position=2900; Antisense; GTTGCACGTCATTGGACCATGTGTT
>probe:Drosophila_2:1635117_at:512:453; Interrogation_Position=2951; Antisense; GATCAAATCACTATCACTATCGAAT
>probe:Drosophila_2:1635117_at:609:413; Interrogation_Position=2989; Antisense; GAGCCACGGTTTTTGGCATTCCTAA
>probe:Drosophila_2:1635117_at:42:273; Interrogation_Position=3051; Antisense; CATATTCAAGTGTGGTTTGTGCAAA
>probe:Drosophila_2:1635117_at:716:205; Interrogation_Position=3141; Antisense; AAGCGAATTTACTGTATGTCCATAC
>probe:Drosophila_2:1635117_at:248:161; Interrogation_Position=3164; Antisense; ACAATAGTCCATTAATTCGCAGTAT
>probe:Drosophila_2:1635117_at:179:475; Interrogation_Position=3200; Antisense; GTTAAACTGAACTCCTTTACAGTGT

Paste this into a BLAST search page for me
CGAGGCGTACGGATCCTGGAAGCAAAGAGTGTAGACGATGCAAGCTCCCCGTCATTACAAACATCTCATCGCTTCAACATCTCATCGCTTCAACTAAAACAAGGTGTAGTCAACCATTCAGCTAAAGCAAAATGCTTCGTCTATTCCTAGGTCTATTCCTAGCATAGTTGCACGTGTTGCACGTCATTGGACCATGTGTTGATCAAATCACTATCACTATCGAATGAGCCACGGTTTTTGGCATTCCTAACATATTCAAGTGTGGTTTGTGCAAAAAGCGAATTTACTGTATGTCCATACACAATAGTCCATTAATTCGCAGTATGTTAAACTGAACTCCTTTACAGTGT

Full Affymetrix probeset data:

Annotations for 1635117_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime